TABLE 1

PCR primers for generating Gateway-compatible MWPyV ST and LT constructs and MWPyV LT LxCxE mutant

ConstructForward primerReverse primer
MWPyV STGGGGACAAGTTTGTACAAAAAAGCAGGCATGATAGAGTTCTTTCTAGAGATGGGGACCACTTTGTACAAGAAAGCTGGGTCGGAGTCCCATAAGTGGGA
MWPyV-LT-exon 1GGGGACAAGTTTGTACAAAAAAGCAGGCATGATAGAGTTCTTTCTAGAGATCCCATAAGTGGGATTTCCCTTTGCAGGAAAATAAACTT
MWPyV-LT-exon 2GGAAATCCCACTTATGGGGGGGACCACTTTGTACAAGAAAGCTGGGTCTTGTGAATTAATTCCAGAGTCT
MWPyV-LT-E109KGGATGGGATGAAGATTTAAGTTGTAATAAATCTTTTGCTCCCAGTGATATCACTGGGAGCAAAAGATTTATTACAACTTAAATCTTCATCCCATCC