TABLE 2

Primers and probes used in this study

Name5′–3′ sequencebPurposeChanges
JCT 1AGAGTGTTGGGATCCTGTGTTTTForward primer to detect JCV T antigen RNANAa
JCT 2GAGAAGTGGGGATGAAGACCTGTTTReverse primer to detect JCV T antigen RNANA
JCT 1.1FAM-TCATCACTGGCAAACATTTCTTCATGGC-TAMRAProbe to detect JCV T antigen RNANA
JRR25CATGGATTCCTCCCTATTCAGCASequencing of NCCRs from early sideNA
JRR28TCACAGAAGCCTTACGTGACAGCSequencing of NCCRs from late sideNA
MAD-1 SWAP Agno FORGTTTTGGCTTGTCACCAGGTACCCATGGTTCTTCGCCAGCGeneration of pMad-1SW by inserting KpnI site on late side of NCCRAGCTTT→GGTACC
MAD-1 SWAP Agno REVGCTGGCGAAGAACCATGGGTACCTGGTGACAAGCCAAAACGeneration of pMad-1SW by inserting KpnI site on late side of NCCRAGCTTT→GGTACC
MAD-1 SWAP Tag FORGATTCCTCCCTATTCAGCACTTTGTCCATTTTACCGGTTTGCAGCAAAAAATTCCTGeneration of pMad-1SW by inserting AgeI site on early side of NCCRGCTGGC→ACCGGT
MAD-1 SWAP Tag REVAGTAATTTTTTGCTGCAAACCGGTAAAATGGACAAAGTGCTGAATAGGGAGGAATCGeneration of pMad-1SW by inserting AgeI site on early side of NCCRGCTGGC→ACCGGT
506 SWAP Agno FORAGCTGTTTTGGCTTGTCACCAACTGGCCATGGTTCTTCGCCAGCRepair of late side KpnI site to wild-type sequenceGGTACC→ACTGGC
506 SWAP Agno REVGCTGGCGAAGAACCATGGCCAGTTGGTGACAAGCCAAAACAGCTRepair of late side KpnI site to wild-type sequenceGGTACC→ACTGGC
506 SWAP Tag FORGATTCCTCCCTATTCAGCACTTTGTCCATTTTGGCTTTTTGTAGCAAAAATTTATTGCAAAAAAGGRepair of early side AgeI site to wild-type sequenceACCGGT→GGCTTT
506 SWAP Tag REVCCTTTTTTGCAATAAATTTTTGCTACAAAAAGCCAAAATGGACAAAGTGCTGAATAGGGAGGAATCRepair of early side AgeI site to wild-type sequenceACCGGT→GGCTTT
482 SWAP Agno FORTTTTGGCTGTCACCAGCTGCCCATGGTTCTTCGCCRepair of late side KpnI site to wild-type sequenceGGTACC→GCTGCC
482 SWAP Agno REVGGCGAAGAACCATGGGCAGCTGGTGACAGCCAAAARepair of late side KpnI site to wild-type sequenceGGTACC→GCTGCC
482 SWAP Tag FORGATTCCTCCCTATTCAGCACTTTGTCCATTTAGCTTTTTGCAGCAAAAAATTACTRepair of early side AgeI site to wild-type sequenceACCGGT→AGCTTT
482 SWAP Tag REVAGTAATTTTTTGCTGCAAAAAGCTAAAATGGACAAAGTGCTGAATAGGGAGGAATCRepair of early side AgeI site to wild-type sequenceACCGGT→AGCTTT
459 SWAP Agno FORGTTTTGGCTTGTCACCAGCTGGCCATGGTTCTTCGCCAGCRepair of late side KpnI site to wild-type sequenceGGTACC→GCTGGC
459 SWAP Agno REVGCTGGCGAAGAACCATGGCCAGCTGGTGACAAGCCAAAACRepair of late side KpnI site to wild-type sequenceGGTACC→GCTGGC
459 SWAP Tag FORGATTCCTCCCTATTCAGCACTTTGTCCATTTTAGCTTTTTGTAGCAAAAAATTAGTRepair of early side AgeI site to wild-type sequenceACCGGT→AGCTTT
459 SWAP Tag REVACTAATTTTTTGCTACAAAAAGCTAAAATGGACAAAGTGCTGAATAGGGAGGAATCRepair of early side AgeI site to wild-type sequenceACCGGT→AGCTTT
399 SWAP Agno FORGTTTTGGCTTGTCACCAGCTGGCCATGGTTCTTCGCCAGCRepair of late side KpnI site to wild-type sequenceGGTACC→GCTGGC
399 SWAP Agno REVGCTGGCGAAGAACCATGGCCAGCTGGTGACAAGCCAAAACRepair of late side KpnI site to wild-type sequenceGGTACC→GCTGGC
399 SWAP Tag FORGATTCCTCCCTATTCAGCACTTTGTCCATTTTAGCTTTTTGTAGCAAAAAATTAGTRepair of early side AgeI site to wild-type sequenceACCGGT→AGCTTT
399 SWAP Tag REVACTAATTTTTTGCTACAAAAAGCTAAAATGGACAAAGTGCTGAATAGGGAGGAATCRepair of early side AgeI site to wild-type sequenceACCGGT→AGCTTT
506 L38 3′ FORTATATATAAAAAAAAGGGAAGGTAATGGCTGCCAGCCAAGCATGAGAbrogation of Spi-B binding to rituximab L38 site by mutation of 3′ endG→T
506 L38 3′ REVCTCATGCTTGGCTGGCAGCCATTACCTTCCCTTTTTTTTATATATAAbrogation of Spi-B binding to rituximab L38 site by mutation of 3′ endG→T
506 L38 CORE FORTCCTGTATATATAAAAAAAAGCCAAGGGGATGGCTGCCAGCCAbrogation of Spi-B binding to rituximab L38 site by mutation of core binding siteGG→CC
506 L38 CORE REVGGCTGGCAGCCATCCCCTTGGCTTTTTTTTATATATACAGGAAbrogation of Spi-B binding to rituximab L38 site by mutation of core binding siteGG→CC
399 L4 FORGTAAACAAAGCACAAGGCCAAGGGAGGAGCTGGCTAAbrogation of Spi-B binding to Natalizumab L4 site by mutation of core binding siteGG→CC
399 L4 REVTAGCCAGCTCCTCCCTTGGCCTTGTGCTTTGTTTACAbrogation of Spi-B binding to Natalizumab L4 site by mutation of core binding siteGG→CC
482 L41 FORCAAGTAAACAAAGCACAAGGCCAAAGGCTAAAACTGGATGGCAbrogation of Spi-B binding to mycophenolate mofetil L41 site by mutation of core binding siteGG→CC
482 L41 REVGCCATCCAGTTTTAGCCTTTGGCCTTGTGCTTTGTTTACTTGAbrogation of Spi-B binding to mycophenolate mofetil L41 site by mutation of core binding siteGG→CC
459 L28 FORGCCTCGGCCTCCTGTATATCCAAAAAAAAGGGAAGGGATGAbrogation of Spi-B binding to HAART L28 site by mutation of core binding siteAG→CC
459 L28 REVCATCCCTTCCCTTTTTTTTGGATATACAGGAGGCCGAGGCAbrogation of Spi-B binding to HAART L28 site by mutation of core binding siteAG→CC
459 L4 FORGTAAACAAAGCACAAGGCCAAGGGATGGCTGCCAGCAbrogation of Spi-B binding to HAART L4 site by mutation of core binding siteGG→CC
459 L4 REVGCTGGCAGCCATCCCTTGGCCTTGTGCTTTGTTTACAbrogation of Spi-B binding to HAART L4 site by mutation of core binding siteGG→CC
  • a NA, not applicable.

  • b FAM, 6-carboxyfluorescein; TAMRA, 6-carboxytetramethylrhodamine. Underlining indicates nucleotides targeted for site-directed mutagenesis.