TABLE 1

Primers and probes for quantitative real-time RT-PCR

Target (reference)Sequence
IFN-α4
    ForwardCAACTCTACTAGACTCATTCTGCAAT
    ReverseAGAGGAGGTTCCTGCATCACA
    ProbeACCTCCATCAGCAGCTCAATGACCTCAAA
IFN-β
    ForwardGCTCCTGGAGCAGCTGAATG
    ReverseTCCGTCATCTCCATAGGGATCT
    ProbeTCAACCTCACCTACAGGGCGGACTTC
SARS-CoV N gene (56)
    ForwardAGGAACTGGCCCAGAAGCTT
    ReverseAACCCATACGATGCCTTCTTTG
    ProbeACTTCCCTACGGCGCTA
β-Actin
    ForwardACGGCCAGGTCATCACTATTG
    ReverseCAAGAAGGAAGGCTGGAAAAGA
    ProbeCAACGAGCGGTTCCGATGCCC