TABLE 1

Genomic regions and PCR primers used for targeted resequencing of SNVs

Genomic regionPrimer namePrimer sequenceGenome region amplifiedSNV nucleotide position: amino acid changea
Block CC-fCAACTTCGCGGGTATGAATCLORF2 (MDV012)17359: promoter
C-rACGCTCCCTAGATCGACTCC17521: synonymous
17545: intronic
Block DD-fACGGCCATTTTTAGTTCGTGUL5 (MDV017)23201: I682R
D-rTGCGAAATTAGAAGCCAAC
Block Pre-EPre-E-fCCGTATGACAGCGAACAAAGUL41 (MDV054)98690: R17stop
Pre-E-rCATCTGGCTAAGCTATGTGCAA
Block EE-fCATTAAACAAACAACAATTGAGCUL42 (MDV055) and UL43 (MDV056)100014: D207G
E-rGCCAAGATGTGAACAACGATT101786: A375T
Block FF-fAGAGAAACCAACGCGACAATUL46 (MDV059)106639: Q117R
F-rATAATGAAGCGGCTCAGCTC
Block B/GG-fAAATTCGCACTTGAGTGTTGGBetween R-LORF11 and R-LORF1212990/128612: intergenic
G-rTCTCATGAAACATACCCCTTCC12986/128616: intergenic
12114/129489: intergenic
Block II-fTCAATCACATATATGGGTCTCAGGICP4 (MDV084/MDV100)145864/178590: S1630P
I-rTCGCGTGGTATCACTGATTG
Block JJ2-fCAGGTGAGGTGGAAGTAGGICP4 (MDV084/MDV100)149985/174469: L256S
J2-rCTGTTCATGTCGGAGGTCTG150169/174285: T195A
150563/173891: Q63H
150567/173887: G62V
  • a Nucleotide position in Md5B40BAC-c1 reference genome HQ149525.1 followed by amino acid change and its position in protein. SNVs in repeat genes have both equivalent positions listed within internal repeat long (IRL)/terminal repeat long (TRL) or internal repeat short (IRS)/terminal repeat short (TRS) indicated.