Table 1

Primer sequences used for qRT-PCR

Gene (ID)Primer
ForwardReverse
IL-1β (NM_008361)CCTCACAAGCAGAGCACAAGAAACAGTCCAGCCCATACTTTAG
Caspase 1 (NM_009807)GGAAGCAATTTATCAACTCAGTGGCCTTGTCCATAGCAGTAATG
ASC (NM_023258)CAGCAACACTCCGGTCAGAGCTGGCTTTTCGTATATTGTG
GFAP (NM_010277)GTGGATTTGGAGAGAAAGGTATTGAGTGCGAATCTC
CD45 (L36091)GCCCAAACAAATTACACATTTAGGCGTTTCTGGAATC
CD4 (NM_013488)GGAAGACTCTCAGACTTATGAAGGTCACTTTGAACAC
CD8 (NM_009857)GTAATGAGCAGACTGTAACCTATATGATGGGCAGACA