Table 1

DNA oligonucleotides used in this work

PrimerSequence
12715′-AGCAGTCGTCTCGTGGCCAAGAAATGGCTTCGAAAGTTTATGAT-3′
12725′-TAGCCCGGGCTACTATTATTGTTCATTTTTGAGA-3′
15445′-CTTGAAAGCGAAAGTAAAGC-3′
22585′-TCTTCCAGCCTCCCATCAGCGTTTGG-3′
22635′-CAACAGAAATCCAACCTAGAGCTGCT-3′
23395′-TGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGC-3′
25885′-CTTTACGATGCCATTGGGA-3′
27105′-GGGGGGATCGATAATTAAGGAGTTTATATGGAAACCCTTAAAGGTAAAGGGGCAGTAGTAATACAA-3′
31535′-ACCACAGTCCATGCCATCAC-3′
31545′-TCCACCACCCTGTTGCTGTA-3′
33065′-TTCCTCCATTCTATGGAGACGCCTTGACCCAAATGCCAGTCTCTTTCTCCTGTATGCAGACCCCAATATGTTGTTATTACTAATTTAGCATCGCCTAGTGGGATGTGTACTTCTG-3′
33075′-TATACATATGGTGTTTTACTAATCTTTTCCATGTGTTAATCCTCATCCTGTCTACTTGCCACACAATCATCACCTGCCATCTGTTTTCCATAATCGCGGATGATCTTTGCTTTTCTTCTTGGC-3′
33755′-GGCCTGAATTCAGGGAGATTCTAAAAGAACCGGTACAT-3′
33765′-TATACATATGGTGTTTTACTAATCTTTTCC-3′
33875′-TTGCTCAATGCCACAGCCAT-3′
33885′-TTTGACCACTTGCCACCCAT-3′
33925′-CGTCCCAGATAAGTGCTAAGG-3′
33955′-GGCGACTGGGACAGCA-3′
33965′-CCTGTCTACTTGCCACAC-3′
34415′-TTTCCTCCATTCTATGGAGACGCCTTGGCCGAGATGCCAGTCTCTTTCTCCTGTATGCAGGCCGAAGTATGTTGTTATTACTAATTTAGCATCGCCT-3′
40835′-AATTCCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCT-3′
40845′-CTTCGTCGCTGTCTCCGCTTCTTCCTGCCATAGGAGG-3′
40855′-AATTCGGATTATGGAAAACAGATGGCAGGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCT-3′
40865′-CTTCGTCGCTGTCTCCGCTTCTTCCTGCCATAGGAGATGCCTGCCATCTGTTTTCCATAATCCG-3′
41215′-AATTCCAGCCATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCT-3′
41225′-CTTCGTCGCTGTCTCCGCTTCTTCCTGCCATGGCTGG-3′
41235′-AATTCCAGCCATGGAAAACAGATGGCAGGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCT-3′
41245′-CTTCGTCGCTGTCTCCGCTTCTTCCTGCCATAGGAGATGCCTGCCATCTGTTTTCCATGGCTGG-3′
43555′-TTCATCGAATTCAGTGCCAAGAAGAAAAGCAAAGATCA-3′