Table 2

Primer sets for strand-specific RT-PCR

Viral targetReactionPrimer
NameSequence (5′–3′)
HK/483 NP
    vRNARTvRNA_483_RTGCCGTCATGGTGGCGAATGAATGGACGAACAAGGATTGC
RT-PCRvRNA_483FGGCCGTCATGGTGGCGAAT
vRNA_483RCTCAGGATGAGTGCAGACCGTGCC
    cRNARTcRNA_483_RTGCTAGCTTCAGCTAGGCATCAGTAGAAACAAGGGTATTTTTCTTC
RT-PCRcRNA_483FGCTAGCTTCAGCTAGGCATC
cRNA_483RCGATCGTGCCTTCCTTTG
    mRNARTmRNA_483_RTCCAGATCGTTCGAGTCGTTTTTTTTTTTTTTTTCTTCAATTGTC
RT-PCRmRNA_483FCCAGATCGTTCGAGTCGT
mRNA_483RCGATCGTGCCTTCCTTTG
CA/09 NP
    vRNARTvRNA_ca09_RTGGCCGTCATGGTGGCGAATAAATGGACGAAGGACAAGGGTTGC
RT-PCRvRNA_ca09FGGCCGTCATGGTGGCGAAT
vRNA_ca09RCTCAGAATGAGTGCTGACCGTGCC
    cRNARTcRNA_ca09_RTGCTAGCTTCAGCTAGGCATCAGTAGAAACAAGGGTATTTTTCTTC
RT-PCRcRNA_ca09FGCTAGCTTCAGCTAGGCATC
cRNA_ca09RCGATCGTGCCTTCCTTTG
    mRNARTmRNA_ca09_RTCCAGATCGTTCGAGTCGTTTTTTTTTTTTTTTTTCTTCAACTGTC
RT-PCRmRNA_ca09FCCAGATCGTTCGAGTCGT
mRNA_ca09RCGATCGTGCCTTCCTTTG