Table 1

Primers used to amplify full-length XPR1 from duck, quail, and chicken cells and XPR1 exons from genomic DNA and primers used for mutation

Primer or primer pairSequence (5′–3′)Amplicon size (bp)
Forward primerReverse primer
a/cATGAAGTTCGCCGAGCACCTCTCGCATGTGTTCACTTCTTTTGCTAGGTCC2,079
b/dCGGCGGCAGGATGAAGTTCGGCTGCATGTGTTCACTTCTTTTGCTAGGTCC2,092
e/fCGAGTGTTCACTGCTCCCTTCCCTGTATTTGCCAGAAGCCCATC163
g/hCATCCCTGCTTGGTTGCGGGAGATGAGGAACTTCAGGGATCAGAGC891
g/jCATCCCTGCTTGGTTGCGGTCGTTTCCAGGGAGAT902
k/lGCTAAAAACCACAGCGACACCGTGGGTAGACAATTCCTTCTCGAAGAAAGG163
m1/o1GCATACTACTATTGTGCCCTGAAAACCTCAAGTGGGGCGAAAACAG140
m2/o2GCGTACTACTATTGTGCCCTGAAAACCTCAAGCGGGGCAAAAACAG140
m3/o3GCTTACTACTACTGTGCCCTGAAAACCTCAAGTGGGGCAAACACAG140
n/o3CCTGCGCTTTGCGTGGACCCTGAAAACCTCAAGTGGGGCAAACACAG105
Primer for mutationa
    E579Q ChickenCCAGATCTCCCTCACTTCCATGCAGATCTTCCCATACG
    Q496K ChickenGCAGCCCTCTACAGCACTCACAAAGCTAAAAACCACAGCGACACC
    Q579E DuckCCAGATCTCCCTCACCTCCATGGAAATCTTCCCGTATGCTGG
    K496Q DuckGCCCTCTACAGCACTCACCAAGCTAAAAACCACAGCGAC
    K496E DuckGCAGCCCTCTACAGCACTCACGAAGCTAAAAACCACAGCGAC
  • a Reverse primers were reverse complements.