Table 1

Oligonucleotide primers or probes used for the construction of plasmids, recombinant BACs, and probe synthesis

Primer or probeaSequencebPurpose
Kanr ForCAACCCTCAGCAGTTTCTTAAGACCCATCAGATGTTTCCAGGCTCCCCCAAGGACCTGAAATGACCGCGGTAGGCGTGTACGGTGGKanr cassette
Kanr RevAACTGCTGAGGGCCAGTGTTACAACCAATTAACC
SFFV-UL82 ForTGAGCCACCCGCCGCACGCGCTTAGGACGACTCTATAAAAACCCACGTCCBAD-SF82
ACTCAGACACGTAACGCCATTTTGCAAGGCATGGA
SFFV-UL82 RevGGCGGGATGGGGGGAGGGTCAGGGGATGCGCAAAGGTGAACGGGTCTTC
GTGGGAGGTCGGCCGAGTGAGGGGTTGTGAG
UL83-UL82 ForCCGAATTGGAAGGCGTATGGScreening primers for BAD-SF82
UL83-UL82 RevGTGCAGGCGACCAAAGCTTC
UL83 probe ForGTCAGAATCTGAAGTACCAGGAATUL83 probe
UL83 probe RevtaatacgactcactatagggTCAACCTCGGTGCTTTTTGGGCG
UL82 probe ForATGTCTCAGGCATCGTCCTCGCCUL82 probe
UL82 probe RevtaatacgactcactatagggCTCACCTCTATGTTGGTACGCAGG
IE1 ForCGTCCTTGACACGATGGAmRNA for IE1
IE1 RevTCTCCTCGAAAGGCTCATGA
GAPDH ForGAGCCAAAAGGGTCATCmRNA for GAPDH
GAPDH RevGTGGTCATGAGTCCTTC
  • a For, forward; Rev, reverse.

  • b The T7 promoter sequence is indicated by lowercase type.