Table 1

Sequences of primer pairs specific to target gene

Target geneOligonucleotide
OrientationSequence (5′–3′)
EV71 viral protein 1 (VP1)ForwardGGTACCCCACGTTTGGAGA
ReverseTAGGACACGCTCCATACTCAAG
Mouse clathrinForwardGCGCCAAAGTGAACAGGTTGAGAA
ReverseGCTTGCTGCTCTTGGGATTGAAGT
Mouse caveolin-1ForwardTGTACCGTGCATCAAGAGCTTCCT
ReverseGTGCTGATGCGGATGTTGCTGAAT
Human clathrinForwardAACAAGATCAACAACCGGGCATCC
ReverseGGACACATCTTTGCACTGCTTGCT
Human caveolin-1ForwardAGTGCATCAGCCGTGTCTATTCCA
ReverseTCTGCAAGTTGATGCGGACATTGC
Human/mouse actinForwardACCAACTGGGACGACATGGAGAAA
ReverseTAGCACAGCCTGGATAGCAACGTA