Table 1

Primers and probes used for the detection of BTV-1 and BTV-8 genome segments

SegmentOligonucleotide position (strain(s))aSequence (5′–3′)5′ fluor
1 (VP1)2261–2279 (1/8)GCCAGGGATTCTCACTTTC
2335–2308 (1/8)GTAGTGTGTAGTTTTGTGTAAAACAGTG
2305–2284 (1)TCATCTCCCACGTATTGCTCCGFAM
2307–2284 (8)TGTCGTCCCCTACATATTGTTCCGHEX
2 (VP2)2865–2846 (1/8)CAAAAACGTGTCCAGAAAAC
2670–2689 (1)ATTAGAGCGGGGCGTATAAG
2758–2778 (8)AGGTATCGGTTCAAACAGAGG
3 (VP3)1652–1673 (1/8)AGACGATATGTTCAACGCATTA
1736–1715 (1/8)CCAGCTCACATCTAGTACGACT
1683–1700 (1)CTAATCGCCGGGGCGCATFAM
1678–1698 (8)CCGACCTAATTGCTGGAGCGCHEX
4 (VP4)472–492 (1/8)AGATACCACCGCTATACATGG
555–532 (1/8)GCATCGATACTAACTTTTCATCAG
498–522 (1)CGTCAAATCTAGTTCCAATCTCCGCFAM
498–522 (8)CGTCAAATTTAGCTCCGATCTCTGCHEX
5 (NS1)1465–1485 (1/8)GGATTGGAATAACCTTGGAAG
1556–1537 (1/8)ACATCGTAGCATAAGCCCTC
1525–1506 (1)CTCGCTGAGCTCCGGTCCTTFAM
1525–1506 (8)TTCACTGAGTTCCGGCCCCTHEX
6 (VP5)519–517 (1)AAGATCTACAGATGCGCCG
657–632 (1)CCATCTCTTTCTACCTCAATCGCATT
566–590 (1)GGAGAAAGAACACATGCGGAGACGGFAM
517–537 (8)GAGGAGGAAAAACAAATGAGG
681–659 (8)CTGAATCGCCTCTTCCTGCATTC
562–581 (8)GAGGTGAAGGAGCGGACGGGHEX
300–322 (1)bAGCGAGGGATACAAGCTAAGTTG
893–867 (1)bGGTACTCAAGAATAGTTGAAACAACAC
301–324 (8)bGAACGTGGAATGCAGACAAAGATC
894–869 (8)bATGATCCAACACAGTCGATACTATCG
7 (VP7)951–970 (1/8)CTTTTGTCTACGCTTGCTGA
1071–1053 (1/8)TGGACTACACATAGGCGGC
1009–991 (1)CCGTGGATCGCGAACTCAGFAM
1011–991 (8)CGCCATGAATCGCAAACTCAGHEX
8 (NS2)704–728 (1/8)GATGAGAAAGATGAAGAGGATAGAG
829–803 (1/8)CTTAGTTATATGAGTTCTTGGGTGTTC
776–750 (1)CATCATCGTCACTCAGAGTCTTCACCTFAM
774–751 (8)TCATCATCGCTCAGGTTCTTCACCHEX
9 (VP6/NS4)637–656 (1/8)CGTAAACAAGGGAAGAAGCC
731–712 (1/8)ATAGTGATCCCGATACTCGC
690–668 (1)TTCCTCGGTACCCTCTCTCTGCGFAM
689–667 (8)TTTTCGGTGTCCTCTTTCTGCGCHEX
10 (NS3)265–282 (1/8)GGAAGCGTTTCGTGATGA
361–339 (1)CTTTAAGCCTCCTAGGTCACTTT
364–340 (8)CTTCTTCAATCCACTTAGATCACTT
304–330 (1)ACGACATGTAAATGAACAAATTCTGCCFAM
305–329 (8)CGCCATGTGAACGAGCAGATTTTACHEX
  • a Numbers in parentheses refer to the strain of BTV (1 indicates BTV-1; 8, BTV-8). Genome positions are provided according to GenBank accession numbers FJ969719 to FJ969728 for BTV-1 and AM498051 to AM498060 for BTV-8.

  • b These primers were used in conventional PCR assays.