Table 3

HHV-6B pre-miRNA sequences and their genomic positions

Pre-miRNASequenceaStrandGenomic location in DRLGenomic location in DRR
hhv6b-miR-Ro6-1GCGCGCUUUCAAGCAGUCCCGAUCUAUGCGACUCACCGUGUCGCGUUGGCAUCGGGCGCUGCUAUAG7555–7621160876–160942
hhv6b-miR-Ro6-2CGGCGACAGCCGCCGCCGCCGUUACUGUCACUGUUCAAAGAACGUGGCCGUUACAGUUUCCGCUGCCGCUGUGGUCGCCGC3745–3825157066–157146
hhv6b-miR-Ro6-3CCGGAGCGGCGACGGAGCCCGCUCGGUAUCGCGGACGUGCGAGACCGAGCGGGCUCCAUCCGCCGCUCGGUC3087–3158156408–156479
hhv6b-miR-Ro6-4GACCGAGCGGCGGAUGGAGCCCGCUCGGUCUCGCACGUCCGCGAUACCGAGCGGGCUCCGUCGCCGCUCCGG+3087–3158156408–156479
  • a The indicated sequences correspond to the sequences used to make the predicted fold-back structures shown in Fig. 3A and in Fig. S1C in the supplemental material. Nucleotides highlighted in bold indicate the mature miRNA sequences. Positions are given relative to the published genomic sequence of the Z29 strain of HHV-6B.