Table 2

Mature HHV-6B miRNA sequences, genomic positions, and distribution in the two librariesa

miRNACloned sequence (major form)StrandSize (nt)No. of reads for total RNANo. of reads for Ago2 IP RNAGenomic location in DRLGenomic location in DRR
hhv6b-miR-Ro6-1AAGCAGUCCCGAUCUAUGCGAC2228725,4497590–7611160911–160932
hhv6b-miR-Ro6-1*CGCGUUGGCAUCGGGCGCUGCUAU2419467557–7580160878–160901
hhv6b-miR-Ro6-2UUACAGUUUCCGCUGCCGCUGU2211055,3213754–3775157076–157096
hhv6b-miR-Ro6-2*CGCCGCCGCCGUUACUGUCACU2226123794–3815157115–157136
hhv6b-miR-Ro6-3-5pGACGGAGUCCGCUCGGUAUCG2110021,4603128–3148 (1)156449–156469 (1)
hhv6b-miR-Ro6-3-3pAGACCGAGCGGGCUCCAUCCG213261,9003097–3117156418–156438
hhv6b-miR-Ro6-4AUACCGAGCGGACUCCGUCGCU+2229473130–3151 (2)156451–156472
hhv6b-miR-Ro6-4*CGGAUGGAGCCCGCUCGGUCUCG+230203097–3119156418–156440
  • a The predominantly cloned sequences are indicated. 5p, 5′ arm of the hairpin precursor; 3p, 3′ arm of the hairpin precursor; *, nonfunctional star sequence. Positions are given relative to the published genomic sequence of the Z29 strain of HHV-6B. Nucleotides in bold denote mismatches to the Z29 genome but matches to the HST strain, nontemplate nucleotides are underlined, and numbers of mismatches are indicated in parentheses.