Table 1

Sequences of siRNA used to suppress ASMase (SMPD1) mRNA expression

siRNA nameVendorCatalog no.Target sequence
Hs_SMPD1_1QiagenSI00011557TGGAATTATTACCGAATTGTA
Hs_SMPD1_2QiagenSI00011564CTGGTTTAGCTGGATATGGGA
Hs_SMPD1_3QiagenSI00011571CGGGCTGAAGAAGGAACCCAA
Hs_SMPD1_5QiagenSI03096121CTGCTGTGGGTAACCATGAAA
SMPD1_6InvitrogenSMPD1HSS143988ACAAAGAGTAGCCAGACGGCAGGGC
Ctbp1_7 (+control)QiagenSI04301325CACCGTCAAGCAGATGAGACA
AllStars (−control)QiagenSI1027281Nontargeting