TABLE 1.

Predicted E. coli promoters within nt 1 to 3000 of the DENV2 and JEV genomes

Virus and E. coli promoterVirus sequenceaScoreb
DENV2
    ECP1
        Wild type160 …ctgacaaagagattctcact… 2050.93
        Mutant160 …ctgacGaagCgGttctcact… 205NDc
    ECP2
        Wild type198 …ggaccattaaaactgttcat… 2430.95
        Mutant198 …ggaccaCtGaaGctgttcat… 243ND
    ECP3
        Wild type376 …actgcaggcatgatcattat… 4210.94
        Mutant376 …actgcaggcCtgatcattat… 421ND
    ECP4
        Wild type633 …ccacatgggtaacttatggg… 6780.97
        Mutant633 …ccacatgggtGacttatggg… 678ND
    ECP5
        Wild type1059 …ccaaacaacctgccactcta… 11040.95
        Mutant1059 …ccaaGcaacctgccacCcta… 1104ND
    ECP6
        Wild type2104 …tctatcggcaaaatgcttga… 21490.98
        Mutant2104 …tctatcggcaGaatgcttga… 2149ND
    ECP7
        Wild type2582 …acaagactggaaaacctgat… 26270.96
        Mutant2582 …acaagactggaGaacctgat… 2627ND
    ECP8
        Wild type2615 …acaccagaattgaatcacat… 26601.00
        Mutant2615 …acaccagaGCtgaaCcacat… 2660ND
JEV
    ECP9
        Wild type60 …aacggaagataaccatgact… 1050.94
        Mutant60 …aacggaagCtaaccatgacg… 105ND
    ECP10
        Wild type72 …catgactaaaaaaccaggag… 1171.00
        Mutant72 …catgacGaaGaaGccaggag… 117ND
    ECP11
        Wild type676 …ctacgtccaatatggacggt… 7210.90
        Mutant676 …ctacgtccaGtaCggacggt… 721ND
    ECP12
        Wild type1352 …ttgggagaacaatccagccagaaaacatcaaat… 13970.94
        Mutant1352 …tCgggagaacaatccagccagaaaacatcaaGt… 1397ND
  • a Mutations introduced into ECPs are indicated by uppercase letters.

  • b The score for the predicted prokaryotic promoter was calculated by a website (http://www.fruitfly.org/seq_tools/promoter.html) search program (Neural Network promoter prediction) from the Berkeley Drosophila Genome Project.

  • c ND, not detectable.