Table 1.

PCR primers and oligonucleotides for construction of plasmids and HCMV BAC DNAs for this study

Primer or oligonucleotideSequence (5′–3′)
XhoIUL79ORFFCCGCTCGAGATGATGGCCCGCGACGAAGAGAACCC
HindIIIUL79ORFRCCCAAGCTTTCACGTCGTTAGCCAGCGTCGGCATAT
XhoIUL95ORFFCCGCTCGAGATGATGGCGGCGGCGGTGGTGCGAGCGGAG
HindIIIUL95ORFRCCCAAGCTTTTAGATTCAACGTGATGAGACCCGCGTCGTTCAGC
XhoIUL87ORFFCCGCTCGAGATGGCCGGCGCTGCGCCGCGCCGCCTCGGCTGCGAC
UL87(815)HindIIIRCAACGCCCAGCCAAAGCTTTTGCAGCTCCAGC
UL87(815)HindIIIFGCTGGAGCTGCAAAAGCTTTGGCTGGGCGTTG
HindIIIUL87ORFRCCCAAGCTTTTCGTGATGCAAACCGCGCTCGCGGCGACGTG
BACdlUL79FRTFKanFGCGGCCGTGTTCGATGAAACGCGCGCCGCCCGTCTCAGCCAGCGCCTGTGTCACCCGCGCTTGAGCGGCGGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCAACTCAGCAAAAGTTCGATTTATTCAAC
BACdlUL79FRTRKanRTTGCGCGCCAGGTCTTCGGGGAAAACGACCGGCAGGCCGGTGTGGCGCTGCACAAAGCGCGTCAGCAGTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCTAATGCTCTGCCAGTGTTACAACCA
BACdlUL87FRTFKanFGTCACTGCCGCGCGACCCGGCCGCAGATCGCGTTCGACGTTACGTATGCATTATCTCGCGGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCAACTCAGCAAAAGTTCGATTTATTCAAC
BACdlUL87FRTRKanRGTCTCCGACCGCCGTTGACAGTGTTTACGCCATCTCTCCCCGTACCGAGCGTACATGAGAGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCTAATGCTCTGCCAGTGTTACAACCA
BACdlUL95FRTFKanFACGACGCCGCCACGCCGTCTTTTCTACGTCGACACGACGTGCTGGAGCGTTTCGCGGCCGGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCAACTCAGCAAAAGTTCGATTTATTCAAC
BACdlUL95FRTRKanRCACGGTCAGCATTGCGTAACGCATAATCACGCACACAAAGCGACGGCAAAGGCTCAGCCGGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCTAATGCTCTGCCAGTGTTACAACCA
BACUL95Nneo+StFCTTCTGCAGCTCCGCGTAGCGCTCCTGGATCTTGGCGGCCGAGTCTCCGCGCAACGGCCTGGTGATGATGGCGGGATC
BACUL95Nneo+StRTTTTCCTCTCCTCTCGCCGCTGCCGCCTAACCTCCGCTCGCACCACCGCCGCCGCTCAGAAGAACTCGTCAAGAAGG
BACUL95Cneo+StFCGGAAAGTTGCTGGACGCCCTCTCGCTGAACGACGCGGGTCTCATCACGTTGAATGGCCTGGTGATGATGGCGGGATC
BACUL95Cneo+StRTCAAGGTCGACGCGCATCACGTCCTTTAAGAGCTGTTTGTTGACCGACGTCATAGTCAGAAGAACTCGTCAAGAAGG
BAColigoHAUL95TTGCGCTTCTGCAGCTCCGCGTAGCGCTCCTGGATCTTGGCGGCCGAGTCTCCGCGCAACATGTACCCATACGATGTTCCAGATTACGCTGCGGCGGCGGTGGTGCGAGCGGAGGTTAGGCGGCAGCGGCGAGAGGAGAGGAAAAAGATG
BACUL95ColigoCCACGTCGGAAAGTTGCTGGACGCCCTCTCGCTGAACGACGCGGGTCTCATCACGTTGAATTACCCATACGATGTTCCAGATTACGCTCTATGACGTCGGTCAACAAACAGCTCTTAAAGGACGTGATGCGCGTCGACCTTGAGCGACA
BACUL87Cneo+StFCAGCGTTGACGGCAGTTCTGAACCCACGTCGCCGCGAGCGCGGTTTGCATCACGAGGCCTGGTGATGATGGCGGGATC
BACUL87Cneo+StRGTCGGACGCTCCTCCGGACGAAACGCCGCGGCGGCAGCGGCCGCGGCTTCCATCATCAGAAGAACTCGTCAAGAAGG
BACUL87oligoTCCGTCAGCGTTGACGGCAGTTCTGAACCCACGTCGCCGCGAGCGCGGTTTGCATCACGAGAACAGAAACTGATCTCTGAAGAAGACCTGTGATGGAAGCCGCGGCCGCTGCCGCCGCGGCGTTTCGTCCGGAGGAGCGTCCGACGCCGG
BACUL79NFneoCACAGCCTGCGGCTGCTGCTCGTCCATCGTCATTGTCGTCACCGTCGCTACCCGCTCACCGAGCGAACGGGCCTGGTGATGATGGCGGGATC
BACUL79NRneoGATTGGCGCAAGTAAAGGAGAATTTGCCTGTGCGGACCCGCGGGACGGCGGGGTTCTCTTCGTCGCGGGCTCAGAAGAACTCGTCAAGAAGG
BAColigoflagUL79GCGGCTGCTGCTCGTCCATCGTCATTGTCGTCACCGTCGCTACCCGCTCACCGAGCGAACGATGGACTACAAAGACGATGACGACAAGGCCCGCGACGAAGAGAACCCCGCCGTCCCGCGGGTCCGCACaGGCAAATTCTCCTTTACTTG
UL79detectFCGCCAGGCCTTCCCGGGGCTGG
UL79detectRCCGTAGAGCGTGCCTAGGGAGAAGAGG
UL87BACdetectFCGATCCGTAAGCCGCGGTTACGG
UL87BACdetectRCGTAAAGTCAAATGGCGGCGTGGCG
UL95BACdetectFGGGAAAAGAACGGCGGTGGGTCTCG
UL95BACdetectRGCTGGAGAGTGACAGCTCCACGTGAGC
UL95NdetectFAGTTCGGGGTGCATCATCT
UL95NdetectRACGACACCACTAGGGACGAC
UL95CdetectFAAGTTGCTGGACGCCCTCTC
UL95CdetectRACACGCATCACCGTCAAAG
UL87CdetectFCCCATTGTGTGTGTCCTCAT
UL87CdetectRCCGTACCGTCGTCCATTAAC
UL79NdetectNGGTCGTAACGGGCGAGAAAGCCG
UL79NdetectRCTGTCCGCGCGACATCTTCTCGC