TABLE 2

Primer for generating SIA binding defective mutants and titer quantification

Primer (VP aa)aSequence (5′–3′)
N447S-FCCAATACCTGTATTACCTGAGCAGAACTCAAAATCAG
N447S-RCTGATTTTGAGTTCTGCTCAGGTAATACAGGTATTGG
S472R-FCTCCAGCTGGCATGCGGGTTCAGCCCAAAAACTG
S472R-RGGGCTGAACACGCATGCCAGCTG
V473D-FGCTGGCATGTCTGACCAGCCCAAAAACTGGC
V473D-RCAGTTTTTGGGCTGATCAGACATGCCAG
N500E-FCAGACAACAACAACAGCGAATTTACCTGGACTGGTGCTTC
N500E-RGCACCAGTCCAGGTAAATTCGCTGTTGTTGTTG
T502S-FCAACAACAGCAATTTTTCGTGGACTGGTGCTTC
T502S-RTTTTGAAGCACCAGTCCACGAAAAATTGCTGTTGTTGTTG
W503A-FCAACAGCAATTTTACCGCTACTGGTGCTTCAAAATATAACC
W503A-RGGTTATATTTTGAAGCACCAGTAGCGGTAAAATTGCTGTTG
Luciferase-FATTACACCCGAGGGGGATGA
Luciferase-RCTCTCACACACAGTTCGCCT
  • a aa, amino acid.