TABLE 1

Primer list for plasmid construction using PCR

Primer target in VP8Primer sequence (5′–3′)
ForwardReverse
Substitutions
    S16AGCCGGAACGTACCGCACGCACGCGGCGCGGGCGGCGCTCAG
    S32AGCCCTGCTGGACGCCCTGCGCCGCCGGGCAGAGGGGCGCTGG
    S65AGCCAGTGAGGACGAGAACGTGTATGATTACGTCCTCGTCCGGGGGCCGCTG
    S66AACCGCTGAGGACGAGAACGTGTATGATTACGTCCTCGTCCGGGGGCCGCTG
    S79AGCCAGCGACAGCGCCGACGACTATGATCGCCGTCGATGTAATCATACACGTTCTC
    S80AAGCGCCGACAGCGCCGACGACTATGATCGCCGTCGATGTAATCATACACGTTCTC
    S82AGCCGCCGACGACTATGATAGCGATTATTTTACTGCGTCGCTGCTATCGCCGTCGATG
    T92ATTGCTGCTAACCGCGGCCCCAATCACAATAATCGCTATCATAGTCGTCGGCGCTG
    T107AACCCGAGCGCGCCCCGGAAGGGTGCGTCTGCGTCCATAGCATCGCC
Deletions
    VP8(D65–110)GCCGACGACTATGATAGCGATTATTTATCATAGTCGTCGGCGCTGTC
    VP8(D65–125)GCCGACGACTATGATAGCGATTATTTCGTCAAGTAGTCTTGCGGGGCAC
    VP8(D16–32)CTGCTGGACGCCCTGCGCGCTGCGGACGCGGCGCGGGCGGCGCTCAGG
    VP8(D79–92)GCTAACCGCGGCCCCAATCACATCGCCGTCGATGTAATCATACACGTTCTC
    VP8(D65–82)GCCGACGACTATGATAGCGATTATTTGTCCTCGTCCGGGGGCCGCTGGAAG
    VP8(D88–110)CCCGAGCGCGCCCCGGAAGGATCATAGTCGTCGGCGCTGTC
    VP8(D65–92)GCCCACCTGCGCGCCATCGAGATCGCCGTCGATGTAATCATACACGTTCTC
Truncations
    VP8(121–742)GCGGTAGATCTGATTCAAGACTACTTGACGGCCCACCTGGGCAGTGAGCGCAACGCAATTAATG
    VP8(219–742)CGGTAGATCTGATTGAGCGGCTGTCGGAAGGGGGCAGTGAGCGCAACGCAATTAATG
    VP8(343–742)CGGTAGATCTGATTGGCGGCATGTACGTGGGCGCCCCTGAGGGCAGTGAGCGCAACGCAATTAATG
    VP8(538–742)GCGGTAGATCTGATTGCGGCGGCCTTCCGCGAAGTGGGCAGTGAGCGCAACGCAATTAATG
    VP8(1–120)GAATCTAGAGCCACCATGGACTACAAAGACGATGACGAGCTCGAGTCAGCCGTGATTGGGGCCGCGGTTAG
    VP8(1–125)GAATCTAGAGCCACCATGGACTACAAAGACGATGACGAGCTCGAGTCACGTCAAGTAGTCTTGCGGGGCAC
    VP8(1–258)GAATCTAGAGCCACCATGGACTACAAAGACGATGACGAGCTCGAGTCACTCCCCCGCAGCCGCAGCG