TABLE 3

Primers for qPCR and qRT-PCR

PrimerOrientationaSequence (5′-3′)
Specific RT primers
    miR-21 stem-loopGTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCAACAGTC
    U6GAATTTGCGTGTCATCCTTG
Real-time primers
    Mature miR-21FTGCGTGTCGTGGAGTC
RCGGGTAGCTTATCAGACTGA
    U6FGCTTCGGCAGCACATATACTAAAAT
RCGCTTCACGAATTTGCGTGTCAT
    Cdc25aFAGAGTCAACTAATCCAGAGAAGG
RAGCAACTGTATGAAAGAGATAACC
    GAPDHFGAGTCAACGGATTTGGTCGT
RGACAAGCTTCCCGTTCTCAG
    UL83 (CN)FGCGAGACCGTGGAACTGC
RTTGCCCTGGATGCGATACTG
    GAPDH-(CN)FGACCCCTTCATTGACCTCAACTA
RTCCTGGAAGATGGTGATGGG
  • a F, forward; R, reverse.