TABLE 1

Primers used for plasmid construction

PlasmidPrimer sequence (5′-3′)
ForwardReverse
pCDH-miR-21-GFPTCTAGACCTTTAGGAGCATTATGAGCATGGATCCAGACTATCCCCATTTCTCCAT
pCDH-Cdc25a-GFPGCTAGCAGTCGTGTTTGTGTTTGACCCGGATCCTCAGAGCTTCTTCAGACGACTG
pCDH-Cdc25a+WT-3′UTR-GFPGCTAGCAGTCGTGTTTGTGTTTGACCCGGATCCCTGCAACATTCCAGCACTGAG
pCDH-Cdc25a+MT-3′UTR-GFPGCTAGCAGTCGTGTTTGTGTTTGACCCGGATCCCTGCAACATTCCAGCACTGAG
pCDH-IE1-GFPGGATCCATGGAGTCCTCTGCCAAGAGGATCCTTACTGGTCAGCCTTGCTTCT
pCDH-IE2-GFPGGATCCATGGAGTCCTCTGCCAAGAGGATCCCTGAGACTTGTTCCT CAG
pCDH-pp65-GFPGAATCCATGGAGTCGCGCGGTCGCCGTTGAATTCTCAACCTCGGTGCTTTTTGGGCGTC
pCDH-pp71-GFPTCTAGAATGTCTCAGGCATCGTCCTCGGGATCCCTAGATGCGGGGTCGACTGCG
pCDH-flag-UL26-GFPATGGACTACAAGGACGACGATGATAAGATGACGAGCAGGCGCGGGATCCTTACGGCAACAGCGCTGATGGC
pGL3-miPPR21GGTACCTGTATTCTGGGTAAGAAGGAGCTCTCGAGCTTACCACCTGGACTCAAAAGG
pGL3cM-Cdc25a-3′UTRGGTACCATACTGCCATTCTAGGTAGGGTGAGCTCCTGCAACATTCCAGCACTGAG
pGL3cM-CCNE2-3′UTRGGTACCAAGATTGGGTAGAACTGGTATCACTCTCGAGCTATACAGAAGACTTCATACCGTAA
pLKO.1-shRNA-21-1CCGGAAACATTACCCAGCATCATTGCTCGAGCAATGATGCTGGGTAATGTTTTTTTTGAATTCAAAAAAAACATTACCCAGCATCATTGCTCGAGCAATGATGCTGGGTAATGTTT
pLKO.1-shRNA-21-2CCGGATCCATATCCAATGTTCTCATTCTCGAGAATGAGAACATTGGATATGGATTTTTTGAATTCAAAAAATCCATATCCAATGTTCTCATTCTCGAGAATGAGAACATTGGATATGGAT
pLKO.1-shRNA-21-3CCGGGACTGATGTTGACTGTTGAATCTCGAGATTCAACAGTCAACATCAGTCTTTTTGAATTCAAAAAGACTGATGTTGACTGTTGAATCTCGAGATTCAACAGTCAACATCAGTC
pLKO.1-scrambleCCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTGAATTCAAAAACCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG
pcDNA3.0-UL83GAATCCATGGAGTCGCGCGGTCGCCGTTGAATTCTCAACCTCGGTGCTTTTTGGGCGTC
pcDNA3.0-GAPDHCGCGGATCCATGGGGAAGGTGAAGGTCGGACCGCTCGAGTACTCCTTGGAGGCCATGTG