TABLE 2

List of primers used for RT-PCR

Gene nameAccession no.Primer and sequenceTma (oC)Product size (bp)
Acetyl-CoA carboxylase (ACC)J03541.1Fwd, ACGTTCGAAGGGCGTACATT60161
Rev, TACGTGGACCATCCCGTAGT
Fatty acid synthase (FASN)J03860.1Fwd, CTTTGGTGGTTCGAGGTGGT60170
Rev, CTGTGGGAACCTTGCTTGGA
Rev, AATATCCGCTCCAATGCCTCC
Prostaglandin receptor 2 (EP2)NM_001083365.1Fwd, CCTTCACGATCTGCGCCTAC6092
Rev, GGGGTTGATGGAGAGGAAGC
Prostaglandin receptor 3 (EP3)NM_001040468.1Fwd, GCTGCTGGTAACGATGCTGA60177
Rev, CGGAGCAGCAGATAAACCCA
Prostaglandin receptor 4 (EP4)NM_001081503.1Fwd, ATGTTCCAGGGTACAGGTTTTGT60175
Rev, GCCTAGCCTGCACGGTGTT
Clyclooxygenase 1 (COX-1)XM_425326Fwd, TCAGGTGGTTCTGGGACATCA60123
Rev, TGTAGCCGTACTGGGAGTTGAA
Clyclooxygenase 2 (COX-2)NM_001167718Fwd, CTGCTCCCTCCCATGTCAGA60123
Rev, CACGTGAAGAATTCCGGTGTT
Cytoplasmic beta actinX00182Fwd, TGCTGTGTTCCCATCTATCG60150
Rev, TTGGTGACAATACCGTGTTCA
  • a Tm, melting temperature.