TABLE 1

Plasmids constructed or used in this study

Constructed plasmidaDescription or primer sequencebRestriction enzymeReference or source
pcDNA4/TO-nTAP/nHA/cTAPMammalian expression vector with N-terminal or C-terminal Strep-I and Strep-II tag followed by Flag tag or with a C-terminal HA tag only or a C-terminal Flag tag only, all under the control of a CMV promoter; Ampr, ZeorInvitrogen
    pcDNA4/TO-nTAP-A55RGACGCGGCCGCGAACAACAGCAGCGAGCNotIThis study
GACTCTAGATCAGCTTCCGATGAAGCXbaI
    pcDNA4/TO-nTAP-A55R BTBGACGCGGCCGCGAACAACAGCAGCGAGCNotIThis study
GACTCTAGATTAGTGGTATCTGGGGAAGCXbaI
    pcDNA4/TO-nTAP-A55R KelchGACGCGGCCGCGTCCATCGAGCTGATCAGCNotIThis study
GACTCTAGATCAGCTTCCGATGAAGCXbaI
    pcDNA4/TO-P65-cTAPATATCGGATCCGCCACCATGGACGAACTGTTCCCCCTCATCTBamHIThis study
ATACTGCGGCCGCGGAGCTGATCTGACTCAGCNotI
    pcDNA4/TO-P65-HAATATCGCGGCCGCGGACGAACTGTTCCCCCTCATCTNotIThis study
ATACTTCTAGATTAGGAGCTGATCTGACTCAGCXbaI
    pCDNA4/TO-B14R-cTAPGCGCGGATCCACCATGACGGCCAACTTTAGTACCCACGTCGCTGCCTCCTCCCTTTTCAAACTGAGGATGAGACCACGCGGCCGCATTCATACGCCGGAATATGGCCGCTGGCTCCCTTCTCGAACTGGGGGTGGCTCCAGCTTCCGCCTCCGCTGCCTCCTCCCTTBamHIThis study
CGGCTCTAGACCGCGGTTACTTGTCGTCATCGTCATCCTTGTAGTCCTCGCCGCTGGCTCCCTTCTCXbaI
pCDNA6/TRMammalian expression vector with the Tet repressor under the control of a CMV promoter; Ampr, BlastrInvitrogen
pCDNA3-Flag/HA/MycMammalian expression vector with Flag or HA tag under the control of a CMV promoter; AmprInvitrogen
    pcDNA3-HA-TAK1GCTGCGGCCGCTTCTACAGCCTCTGCCNotIThis study
GTCTCTAGATCATGAAGTGCCTTGTCGXbaI
    pcDNA3-HA-TAB1GCTGCGGCCGCATGGCGGCGCAGAGGAGGAGCNotIThis study
GTCTCTAGACTACGGTGCTGTCACCACGCTXbaI
    pcDNA3-Flag-KLHL12Gift from Randall T. Moon
    pcDNA3-Flag-CUL3Addgene, 19893
    pcDNA3-Flag-CUL5Addgene, 19895
M5P-FlagMammalian expression vector with Flag tag under the control of the murine leukemia virus long terminal repeat promoter; Ampr
    M5P-Flag-TRAF6Gift from Andrew Bowie
pCW57-GFP-P2A-MCSLentiviral expression plasmid with GFP in MSC1 and P2A skip sequence followed by MCS2 under the control of a CMV promoter; Ampr, PurorAddgene, 89181
    pCW57-GFP-P2A-nTAP-A55RCGACGCGTATGTGGTCTCATCCTCAGTTTGMluIThis study
GCAGGATCCTCAGCTTCCGATGAAGCTTTCBamHI
    pCW57-GFP-P2A-nTAP-A55R BTBCGACGCGTATGTGGTCTCATCCTCAGTTTGMluIThis study
GCAGGATCCTCAGTGGTATCTGGGGAAGCBamHI
    pCW57-GFP-P2A-nTAP-A55R KelchCGACGCGTATGTGGTCTCATCCTCAGTTTGMluIThis study
GCAGGATCCTCAGCTTCCGATGAAGCTTTCBamHI
    pCW57-GFP-P2A-nTAP-B14RCGACGCGTATGTGGTCTCATCCTCAGTTTGMluIThis study
    GCAGGATCCTCAATTCATACGCCGGAATATBamHI
    pCW57-GFP-P2A-nTAP-C6LCGACGCGTATGTGGTCTCATCCTCAGTTTGMluIThis study
    CGACGCGTTTATCATCTGTCCACGTCGTMluI
pCMV-PACKPackaging plasmid for lentivirus production with HIV Gag, Pol, Rev, and Tat under the CMV promotor; AmprGift from H. Laman
pCMV-ENVVSV-G pseudotyped envelope protein under the CMV promoter for lentivirus production; AmprGift from H. Laman
pLDT-TetRLentiviral expression plasmid constitutively expressing the tetracycline promoter repressor; Ampr, Neor41
pLDT-MCSLentiviral expression plasmid with expression under the control of a tetracycline-inducible CMV promoter; Ampr, Puror41
    pLDT-nTAP-A55RCTAGCTAGCATGTGGTCTCATCCTCAGTTTGNheIThis study
GCGGTCGACTCAGCTTCCGATGAAGCTTTCSalI
    pLDT-nTAP-B14RCTAGCTAGCATGTGGTCTCATCCTCAGTTTGNheIThis study
CGGAATTCTCAATTCATACGCCGGAATATEcoRI
    pLDT-nTAP-C6LCTAGCTAGCATGTGGTCTCATCCTCAGTTTGNheIThis study
GAGCTCGAATTCTTATCATCTGTCCACGTCGTEcoRI
pCAGGS-FlagMammalian expression vector with a Flag tag under the control of the CMV immediate early promoter; Ampr
    pCAGGS-Flag-KPNA131
    pCAGGS-Flag-KPNA231
    pCAGGS-Flag-KPNA331
  • a Parental plasmids are in boldface. GFP, green fluorescent protein; MCS, multiple cloning site; CMV, cytomegalovirus.

  • b Restriction sites are underlined. Ampr, ampicillin resistance; Puror, puromycin resistance; Neor, neomycin resistance; Zeor, zeocin resistance; Blastr, blasticidin resistance; VSV-G, vesicular stomatitis virus protein G.