TABLE 1.

Primers used for genotyping CTLA4 SNPs using fluorescence polarization

SNP (NCBI reference no.)Amplification primers (5′ to 3′)Extension primer (5′ to 3′)a
ForwardReverse
−T1722C (rs733618)AAAAGTGAAAAACAAATGTTCCACTTTAGCCCATGTTATTCTTCTGAACACACAGCAGTGGCAGGGACAG (R)
−A1661G (rs4553808)TCCTCTTGAGGGCAGGAACATGTGCCATGTTGGTGTGATGCAGACTGGGCAACAGAGGTTTTT (R)
−C658TbTTGGGTTGGCTTTTCTTTGGACACCATCCTTCTAATGGTCCCTTGATCACAAGAAATAAACTGAAAATAGGC (R)
−C318T (rs5742909)GGATGGTTAAGGATGCCCAGAAGGAAGCCGTGGGTTTAGCTGCTCCAAGTCTCCACTTAGTTATCCAGATCCT (F)
+A49G (rs231775)GACCTGAACACCGCTCCCATATGACTGCCCTTGACTGCTGAAGCACAAGGCTCAGCTGAACCTGGCT (F)
+G6230A (rs3087243)CTGCAAGTCATTCTTGGAAGGAGATCAAAATGGCTGCAAGGGATTTCTTCACCACTATTTGGGATATAAC (F)
  • a F, forward; R, reverse.

  • b The rs number is not available at http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=snp. The flanking sequence for this SNP is GCTTCTTTTC(C/T)GCCTATTTTC.