TABLE 1.

Mutations at the amino acid positions of gp120

VirusaLectin (dose [μg/ml])cCodons and amino acid assignation(s) at positionb:
60136162200202204206248259261270271272305311322369430434470
Wild typeWild typeACAAGAACGAATACGAATACAACAAACTCTAACWACAATAGAACTCAAACTAATGGGAAG
TRTNTNTTNSNN/YNRTQTNGK
GNA-1.0GNA (0.5)AAKTAC
N/KY
GNA-1.1aGNA (10) (SN)AYAARTAAKTYTTACATTRAT
T/IN/SN/KF/SYID/N
GNA-1.1bGNA (10) (SN)ARTAAKTYTTACATTRAT
N/SN/KF/SYID/N
GNA-1.2GNA (100) (SN)ATCAYGAARTTTWACTACATTAYTRAT
MT/MN/KFN/YYIT/ID/N
GNA-2.1aGNA (100) (CS)AYAATGAAGTYTTACWATATTRAT
T/IMKF/SYN/YID/N
GNA-2.1bGNA (100) (CS)AYAATGAAGTYTTACWATATTAYTRAT
T/IMKF/SYN/YIT/ID/N
HHA-1.1HHA (1) (SN)ARARCAAAMAACWATARAATT
R/KT/AN/KNN/YR/KI
HHA-1.2HHA (2.5) (SN)ARAGCAAAMAACATT
R/KAN/KNI
HHA-1.3HHA (10) (SN)ARAGCAAAAAACTATATT
R/KAKNYI
HHA-2.1HHA (20) (CS)AYGATAAYAYCTTACATTCWAATT
T/MIT/IS/PYIQ/LI
HHA-2.2HHA (100) (CS)dAYGAYGATAAYAYCTTACAYTATTGRGARG
T/MT/MIT/IS/PYT/IIG/EK/R
  • a GNA-1.1b and GNA-2.1b represent the virus isolates GNA-1.1a and GNA-2.1a that were subcultured for an additional three passages without drug before they were prepared for DNA sequencing.

  • b Nucleotide mixtures in the sequencing reaction were designated as follows: M, C and A; Y, C and T; R, G and A; W, A and T; K, T and G. The wild-type sequence has been determined by sequencing of the wild-type HIV-1(IIIB) strain used in the experiments. Only amino acid changes compared to the wild-type virus are indicated. The amino acid and position numbering have been designated according to the numbering shown in Fig. 2.

  • c SN, virus isolates obtained after serial subcultivations of virus-infected cell cultures, transferring culture supernatant at each subcultivation.

  • d CS, virus isolates obtained after serial subcultivations of virus-infected cell cultures, transferring cell-containing culture fluids at each subcultivation.