TABLE 1.

Primer pairs used to generate lamin A subclones

Primer pairLamin A codonsName of encoded proteinPlasmid
GCCGCCATGGAGACCCCGTCCCAGCGG and TCATTACAGCCGAGCCTGAGCAGCT1-129GST/HeadpJB326
GCCGCCATGGCGCGCAATACCAAGAAGGA and TCAGTCAGTCACGCTCTCAAACTCACGCTGCT117-239GST/Rod1pJB327
GCCGCCATGGAGACCAAGCGCCGTCATGA and TCAGTCAGTCACCAGGCGTAGCCTCTCCTCCT216-384GST/Rod2pJB328
TCCGACATGGAGATCCACGCCTA and TCAGTCAGTCACGGTGTTCTGTGCCTTCCACA369-519GST/Tail1pJB329
GCCGCCATGGGGCAGGTGGTGACGATCT and TCAGTCAGTCACGTTCTGGGGGCTCTGGGTT490-660GST/Tail2pJB330