TABLE 1.

Primers used for construction of WNV reporter replicons

PrimeraPrimer sequencebAmplified fragment
F-IRESataattATGCATCCGCCCCTCTCCCTC (NsiI)IRES
R-IRESc GCAATCCATCTTGTTCAATCATGGTATTATCATCGTGTTTTTCAAAGG
F-NeocCCTTTGAAAAACACGATGATAATACCATGATTGAACAAGATGGATTGCNeo
R-NeocacaaccATGCATCAGAAGAACTCGTCAAGAAG (NsiI)
F-RluctacactCTTAAGATGGCTTCCAAGGTGTACGA (AflII)Rluc
R-RluccacaagCTTAAGCTGCTCGTTCTTCAGCACG (AflII)
  • a The primers were named according to their polarity (F, forward sense primer; R, reverse antisense primer) followed by the name of the amplified fragment (IRES, Neo, or Rluc).

  • b Sequences from IRES, Neo, Rluc, or WNV are in uppercase letters. Extra tail sequences to facilitate restriction enzyme digestion are in lowercase letters. Restriction endonuclease sites are underlined and indicated in parentheses.

  • c Sequences from IRES and WNV are shown in regular uppercase. Sequence from the Neo gene is in italicized uppercase.