TABLE 1.

Oligonucleotides used for RT-PCR and RACE of the JFH-1 genome

Method or segmentOligonucleotideSequences (5′-3′)
5′RACERTGTACCCCATGAGGTCGGCAAAG
45-nt RNA adapterGCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA
5′RACEouter-SGCTGATGGCGATGAATGAACACTG
5′RACEouter-RGACCGCTCCGAAGTTTTCCTTG
5′RACEinner-SGAACACTGCGTTTGCTGGCTTTGATG
5′RACEinner-RCGCCCTATCAGGCAGTACCACAAG
3′RACECAC-T35CACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
3X-10SATCTTAGCCCTAGTCACGGC
nt 129-236744S (1st PCR)CTGTGAGGAACTACTGTCTT
2445RTCCACGATGTTCTGGTGAAG
17S (2nd PCR)CGGGAGAGCCATAGTGG
2367RCATTCCGTGGTAGAGTGCA
nt 2285-46652099S (1st PCR)ACGGACTGTTTTAGGAAGCA
4706RTTGCAGTCGATCACGGAGTC
2285S (2nd PCR)AACTTCACTCGTGGGGATCG
4665RTCGGTGGCGACGACCAC
nt 4574-70024547S (1st PCR)AAGTGTGACGAGCTCGCGG
7027RCATGAACAGGTTGGCATCCACCAT
4594S (2nd PCR)CGGGGTATGGGCTTGAACGC
7003RGTGGTGCAGGTGGCTCGCA
nt 6949-96346881S (1st PCR)ATTGATGTCCATGCTAACAG
3X-75RTACGGCACTCTCTGCAGTCA
6950S (2nd PCR)GAGCTCCTCAGTGAGCCAG
3X-54RGCGGCTCACGGACCTTTCAC