TABLE 1.

Sequences of the primers and TaqMan probe

AnalysisPrimer or probeSequence (5′→3′)
RTRabies RT for genomeCTGCTTGTAAACCAGGCATTCCCGGATGTCTG
Rabies RT for anti-genomeAAACAATCAAACAGCCAGAGGTCCAGATTC
SYBR green assayHuman GAPDH FCCTCCTGTTCGACAGTCAGC
Human GAPDH RCGCCCAATACGACCAAATC
TaqMan assayRabies TaqMan probeTGATGTGTCTCGAAAA
Rabies genome FGTCTGCACATGCTGAGACTCTTG
Rabies genome RACAGCCAGAGGTCCAGATTCA