TABLE 1.

Sequences of primers used for reverse transcription-PCR

Gene namePrimer
DirectionSequence(5′ to 3′)
tcdA ForwardGCAGCTACTGGATGGCAAAC
ReverseATCTCGAAAAGTCCACCAGC
tcdB ForwardTCATTTGACGATGCAAGAGC
ReverseCCTTTCCTCAACAATTTGCG
tcdR ForwardTCAAAGTAAGTCTGTTTTTGAGGAA
ReverseTGCTCTATTTTTAGCCTTATTAACAGC
tcdC ForwardGGTTCAAAATGAAAGACGACG
ReverseGCACCTCATCACCATCTTCA
tcdE ForwardTGGAGGAATCAGAAAAGTAGCA
ReverseCATTTCATCTGTCATTGCATCT
16SrRNAForwardACACGGTCCAAACTCCTACG
ReverseAGGCGAGTTTCAGCCTACAA
int ForwardATGAATATCAAATCAGCTTTTAT
ReverseTGAATAAATACTCCCATGTACTT
repR ForwardCTGTCATCATCATTGAGAGAATA
ReverseGGGAAAGTGATAGAAGATTTCCT
CD2693ForwardGTGCCCAAACTAATCATCGG
ReverseGCTAACATTCCTGCCTCTGG
CD2694ForwardAAAATGCTAAATTTGGTTTGT
ReverseCTCCAAATTAAAACTATAGCATCA