TABLE 1.

Primers used for the mutagenesis of ORF31 in the self-excisable pOka-BAC

Primer usePrimer namePrimer sequence
Furin site deletiongB[31]-d491RSRR494-FCACTAATCATTCACCACAAAAACACCCGACTCGAAATACCAGCGTGCCAGTTGAGTTGAGGATGACGACGATAAGTAGGG
gB[31]-d491RSRR494-RGTTATTGTTCTATTGGCACGCAACTCAACTGGCACGCTGGTATTTCGAGTCGGGTGTTCAACCAATTAACCAATTCTGATTAG
Furin site mutagenesisgB[31]_491GSGG494_FCACTAATCATTCACCACAAAAACACCCGACTCGAAATACCGGTTCCGGAGGAAGCGTGCAGGATGACGACGATAAGTAGGG
gB[31]_491GSGG494_RGTTATTGTTCTATTGGCACGCAACTCAACTGGCACGCTTCCTCCGGAACCGGTATTTCGCAACCAATTAACCAATTCTGATTAG
Amplification ofgB[31]nt1431-1456FCACTAATCATTCACCACAAAAACACC
    cloned productgB[31]nt1495-1520RGTTATTGTTCTATTGGCACGCAACTC
Fusion loop point mutationsgB[31]_W180G_FGCGACGGTATATTACAAAGATGTTATCGTTAGCACGGCGGGGGCCGGAAGTTCTTATACGAGGATGACGACGATAAGTAGGG
gB[31]_W180G_RCATATCTATTAGTAATTTGCGTATAAGAACTTCCGGCCCCCGCCGTGCTAACGATAACATCAACCAATTAACCAATTCTGATTAG
gB[31]_Y185G_FCAAAGATGTTATCGTTAGCACGGCGTGGGCCGGAAGTTCTGGTACGCAAATTACTAATAGATAGGATGACGACGATAAGTAGGG
gB[31]_Y185G_RAATTGGTACCCTATCAGCATATCTATTAGTAATTTGCGTACCAGAACTTCCGGCCCACGCCGCAACCAATTAACCAATTCTGATTAG
Reversion of fusion loop pointgB[31]_W180G-R_FGCGACGGTATATTACAAAGATGTTATCGTTAGCACGGCGTGGGCCGGAAGTTCTTATACGAGGATGACGACGATAAGTAGGG
    mutationsgB[31]_W180G-R_RCATATCTATTAGTAATTTGCGTATAAGAACTTCCGGCCCACGCCGTGCTAACGATAACATCAACCAATTAACCAATTCTGATTAG
gB[31]_Y185G-R_FCAAAGATGTTATCGTTAGCACGGCGTGGGCCGGAAGTTCTTATACGCAAATTACTAATAGATAGGATGACGACGATAAGTAGGG
gB[31]_Y185G-R_RAATTGGTACCCTATCAGCATATCTATTAGTAATTTGCGTATAAGAACTTCCGGCCCACGCCGCAACCAATTAACCAATTCTGATTAG
Amplification ofgB[31]nt499-523GCGACGGTATATTACAAAGATGTTAT
    cloned productgB[31]nt552-577CATATCTATTAGTAATTTGCGTATAA
gB[31]nt513-538CAAAGATGTTATCGTTAGCACGGCGT
gB[31]nt568-594AATTGGTACCCTATCAGCATATCTATT