TABLE 1.

Sequences of the 3′ ends of full-length I gene transcripts

GeneTranscript 3′-end sequencea
382ATAAGGCCATATG
ATAAGGCCATATGA
ATAAGGCCATATGAAA
ATAAGGCCATATGAAAAAAA (3)
ATAAGGCCATATGAAAAAAAAAA
ATAAGGCCATATGAAAAAAAAAAAAAA
ATAAGGCCATATGAAAAAAAAAAAAAAAA
ATAAGGCCATATGAAAAAAAAAAAAAAAAAAA
ATAAGGCCATATGAAAAAAACTAACAGTAAT
GFPATCCCCCCATATGAAAA (2)
ATCCCCCCATATGAAAAAAA
ATCCCCCCATATGAAAAAAAAAA
ATCCCCCCATATGAAAAAAAAAAA
ATCCCCCCATATGAAAAAAAAAAAAAAAAA
ATCCCCCCATATGAAAAAAAAAAAAAAAAAAAA
ATCCCCCCATATGAAAAAAAAAAAAAAAAAAAAAAAA
  • a The sequences at the 3′ ends of the full-length transcripts obtained from RNA transcribed in vitro with polymerase H1227A are shown. The numbers in parentheses indicate multiple independent isolates of the same sequence. The underlined A residues are presumably derived from polymerase slippage on the U tract.