TABLE 3.

Comparison of complete genomic sequences of Dumas and Oka strains of VZVa

Feature relative to WT (Dumas)Position (WT)Feature in:Position in:
Oka-POka-VOka-VGSKOka-VMerckOka-VGSKOka-VMerck
A→G1XXXX11
G→C3XXXX33
Deletion of C (from WT)109XXXX109109
G→C178--XX177177
A→G236XXXX235235
C→T262XXXX261261
T→C560-XXX559559
G→A (ORF 1), N, silent685XXXX684684
T→T/C (ORF 1), Q, silent703-XCC702702
T→T/C (ORF 1), P, silent763-XCC762762
T→C (ORF 1), T→A789XXXX788788
T→C (ORF 1), Q→R790XXXX789789
T→C (ORF 1), Q→R791XXXX790790
C→G (ORF 2), G, silent1838-X--18371837
T→T/C2515-XC-25142514
A→G (ORF 4), T, silent3764XXXX37633763
C→T (ORF 5), K, silent4258XXXX42574257
A→G (ORF 6), S→P5745-XXA/G57445744
G→T (ORF 6), H→Q6853XXXX68526852
C→A (ORF 6), G→V7091XXXX70907090
C→T (ORF 6), P, silent7753XXXX77527752
T→C9460XXXX94599459
G→A (ORF 8), P→S10079XXXX1007810078
T→C/T (ORF 9A), W→R10900-XX-1089910899
T→G (ORF 9), S, silent11890XXXX1188911889
A→G (ORF 9), T→A11906XXXX1190511905
C→A (ORF 10), P→H12188XXXX1218712187
T→C (ORF 10), F→S12284XXXX1228312283
T→C (ORF 10), F→S12285XXXX1228412284
C→C/T (ORF 10), A→V12779-XX-1277812778
T→G (ORF 10), G, silent13173XXXX1317213172
G→A13407XXXX1340613406
Deletion (ORF 11, R1), ATTGACGACGAGGGAGAGGCGGAGGAGGGAGAGGCGGAGGAGGGAGAGGCGGAGGAGGGAGAG, IDDEGEAEEGEAEEGEAEEGE14088XXXX1408614086
Deletion (ORF 11, R1), GCGGAGGAGGACGCG, AEEDA14199-213XXXX14134-4814134-48
Insertion (ORF 11, R1), CGCGATCGACGACGAGGGAGAGGCGGAGGAGGA14242X-XX14164-9614164-96
T→C14390XXXX1434414344
C→T (ORF 12), V, silent17404XXXX1735817358
C→T (ORF 12), L, silent17834XXXX1778817788
C→T (ORF 12), T, silent18082XXXX1803618036
G→A (ORF 13), K, silent18467XXXX1842118421
T→T/C (ORF 14), stop19431-X--1938519385
A→G (ORF 14), I, silent19719XXXX1967319673
T→A (ORF 14), Y→F20656XXXX2061020610
T→C (ORF 14), T→A20684XXXX2063820638
C→C/T (ORF 14), K, silent20703--X-2065720657
A→T (ORF 14), E→V20711XX--2066520665
C→A (ORF 14), C→A20745XX--2069920699
T→A (ORF 14), T→S20753XXXX2070720707
C→A (ORF 14), K→N20787XXC/A-2074120741
C→A (ORF 14), K→N20829XXC/AC/A2078320783
T→A/T (ORF 14), T→S20837--XX2079120791
C→A (ORF 14), K→N20871--C/AC/A2082520825
A→T (ORF 14), S→T20879--A/T2083320833
C→A (ORF 14), K→N20913--A/CA/C2086720867
T→A (ORF 14), T→S21005XXXX2095920959
G→A (ORF 15), L, silent21371XXXX2132521325
G→T (ORF 15), R, silent21734XXXX2168821688
G→A (ORF 15), S, silent22311XXXX2226522265
A→G22504XXXX2245822458
A→G (ORF 16), M→T22794XXXX2274822748
A→G (ORF 16), F, silent23294XXXX2324823248
Deletion (ORF 17), dCAT (delS)24516XXXX2446924469
A→G (ORF 17), T→A24578XXXX2452924529
C→T (ORF 17), T→M24654XXXX2460524605
G→A (ORF 17), V→I25067XXXX2501825018
A→G (ORF 18), N, silent26125-XXA/G2607626076
A→G (ORF 19), H, silent27523XXXX2747427474
T→G (ORF 20), G, silent29201XXXX2915229152
C→T/C (ORF 21), T→I31732-X--3168331683
A→G (ORF 21), T→A32274XXXX3222532225
T→C (ORF 21), H, silent33722XXXX3367333673
T→C (ORF 21), D, silent33725XXXX3367633676
T→C (ORF 21), N, silent33728XXXX3367933679
T→C (ORF 22), V, silent35543XXXX3549435494
A→G (ORF 22), L, silent37649XXXX3760037600
A→G (ORF 22), I→V37902XXXX3785337853
T→C (ORF 22), T, silent38036--C/TC/T3798737987
T→C (ORF 22), Y→H38055XXXX3800638006
A→C (ORF 22), P, silent38081XXXX3803238032
G→A (ORF 22), E, silent38177XXXX3812838128
G→T (ORF 22), T, silent38714XXXX3866538665
C→T (ORF 22), A, silent38717XXXX3866838668
A→G (ORF 22), R, silent39023XXXX3897438974
T→T/G (ORF 22), P, silent39227-XX-3917839178
G→A (ORF 22), Q, silent39263XXXX3921439214
G→A (ORF 22), R→H39394XXXX3934539345
A→G (ORF 22), V, silent39530XXXX3948139481
A→G (ORF 22), Q, silent40388XXXX4033940339
T→C (ORF 22), P, silent41057XXXX4100841008
G→A41452XXXX4140341403
C→T (R3 repeat), A→V41458XXXX4140941409
G→C (R3 repeat), A→V41459XXXX4141041410
C→T (R3 repeat), A→V41476X-XX4142741427
Deletion, GCGCAGCCC41475-83-X--41426-3441426-34
G→C (R3 repeat), A→V41476X-XX4142741427
Deletion, GCGCAGCCCGCGCAGACCGTCCAGCCCGCGCAGCCC, AQPAQTVQPAQP41484-519XX--41435-7041435-70
C→T (R3 repeat), A→V41485--X-4143641436
C→C/T (R3 repeat), A→V41494--X-4144541445
A→C (R3 repeat), T→P41499--XX4145041450
C→T (ORF 22), T, silent41618XXXX4156941569
G→A (ORF 22), S→N41764XXXX4171541715
C→G (ORF 22), Q→E42069XXXX4202042020
C→T (ORF 22), R, silent42176XXXX4212742127
A→C (ORF 22), A, silent42242XXXX4219342193
42403Del AAADel AAIns ADel A4235542353
T→G (ORF 23), S, silent42476XXXX4242842426
T→C (ORF 24), I→V43262XXXX4321443212
C→T (ORF 26), C, silent44835XXXX4478744785
A→G (ORF 28), C→R47162XXXX4711447112
C→T (ORF 28), L, silent47940XXXX4789247890
T→C (ORF 28), S→G48050XXXX4800248000
G→A (ORF 28), T, silent48825XXXX4877748775
G→A (ORF 28), L, silent49535XXXX4948749485
C→A (ORF 28), G→C50081XXXX5003350031
C→T (ORF 29), S, silent51168XXXX5112051118
A→G (ORF 29), Q, silent52917XXXX5286952867
A→C (ORF 29), I→L53482XXXX5343453432
G→A (ORF 29), A→T53938XXXX5389053888
Deletion (ORF 29), ACATTTCAGGGTCAA, NISGS54359-73XXXX5431054308
Deletion, T54562XXXX5449854496
T→C54564XXXX5450054498
A→G (ORF 30), P, silent55820XXXX5575655754
A→C (ORF 31), T→P57224XXXX5716057158
A→C (ORF 31), A, silent57301XXXX5723757235
G→T (ORF 31), A, silent57397XXXX5733357331
A→G (ORF 31), I→V58595-A/GA/GX5853158529
A→A/G (ORF 31), P, silent59287-XXX5922359221
Insertion, G59760XXXX5969759695
Deletion60278Del5ADel5ADel ADel AA6021460211
A→C60279XXXX6021560212
C→A (ORF 33), A, silent60405XXXX6034160338
T→G (ORF 33), Y→S60781XXXX6071760714
G→A (ORF 33), P→L61018XXXX6095460951
G→A (ORF 33), P→L61019XXXX6095560952
T→C (ORF 33), N→G61201XXXX6113761134
T→C (ORF 33), N→G61202XXXX6113861135
A→G (ORF 35), A, silent64067-XXA/G6400364000
A→G (ORF 35), C, silent64136XXXX6407264069
T→C (ORF 35), P, silent64259XXXX6419564192
T→C (ORF 35), M→V64375XXXX6431164308
C→T (ORF 36), A, silent64989XXXX6492564922
C→T (ORF 36), S→L65669XXXX6560565602
G→T (ORF 37), L, silent66646XXXX6658266579
C→T (ORF 37), P→L66879XXXX6681566812
G→A (ORF 37), R→K68172XXXX6810868105
A→G (ORF 38), T, silent69349XXXX6928569282
T→C (ORF 38), S→G69756XXXX6969269689
T→C (ORF 39), M→T71252-XXC/T7118871185
C→T (ORF 40), V, silent72997XXXX7293372930
T→C (ORF 40), T, silent73993XXXX7392973926
C→T (ORF 41), V, silent76530XXXX7646676463
Deletion, T78144XXXX7807978076
G→T80244XXXX8017980176
A→G (ORF 44), N→D80840XXXX8077580772
C→T (ORF 44), A, silent81187XXXX8112281119
A→A/G (ORF 45), P, silent82225-X--8216082157
G→A/G (ORF 47), E, silent84091-X--8402684023
A→G (ORF 47), T, silent84616XXXX8455184548
G→A (ORF 48), R→H84983XXXX8491884915
C→T (ORF 48), D, silent85563XXXX8549885495
A→A/G (ORF 48), T→A85594--XX8552985526
C→A (ORF 48), Q→K86170XXXX8610586102
Deletion, CCTGATAAAC86484-93XXXX8641886415
T→G86556XXXX8648186478
A→A/G (ORF 50), C, silent87280-X--8720587202
T→C/T (ORF 50), S→G87306-X--8723187228
C→T (ORF 50), S, silent87841XXXX8776687763
G→T (ORF 51), S, silent88477XXXX8840288399
A→G (ORF 51), T, silent89734-XX-8965989656
T→C (ORF 51), T, silent89905XXXX8983089827
G→T (ORF 51), Q→H90202XXXX9012790124
T→C (ORF 51), S, silent90217XXXX9014290139
G→A90392XXXX9031790314
A→A/G (ORF 52), I→V90535-XX-9046090457
C→T (ORF 52), G, silent91191XXXX9111691113
A→G (ORF 52), T→A92026XXXX9195191948
A→G (ORF 52), T→A92092XXXX9201792014
A→G (ORF 52), H→R92375XXXX9230092297
T→C (ORF 53), V, silent92999XXXX9292492921
T→C (ORF 54), L, silent94167-XXT/C9409294089
A→G (ORF 54), V, silent94632XXXX9455794554
A→T (ORF 54), T, silent94641XXXX9456694563
T→C (ORF 54), G, silent95241XXXX9516695163
G→A (ORF 54), L, silent95546XXXX9547195468
T→G (ORF 54), E→D95601XXXX9552695523
T→C (ORF 55), L, silent97141XXXX9706697063
T→T/C (ORF 55), V→A97479---X9740497401
C→T (ORF 55), I, silent97591XXXX9751697513
G→A/G (ORF 55), A→T97748-XXX9767397670
T→C/T (ORF 55), C→R97796-XX-9772197718
T→C (ORF 55), G, silent98437XXXX9836298359
T→C (ORF 56), V, silent98765XXXX9869098687
A→C (ORF 56), T, silent98807XXXX9873298729
Deletion (ORF 56), TTC, S99227-29XXXX9914899145
T→G (ORF 57), H→P99421XXXX9934399340
A→G (ORF 58), Y, silent99709XXXX9963199628
C→T (ORF 58), V→I99981XXXX9990399900
T→A (ORF 58), K→N100114XXXX100036100033
T→G (ORF 58), N→T100151XXXX100073100070
A→G100283XXXX100205100202
A→A/G (ORF 59), L→P101089XXXX101011101008
C→T (ORF 60), A→T101331XXXX101253101250
Insertion (ORF 60), ATC101623XXXX101543-101545101540-101542
T→C101886XXXX101811101808
C→T101991XXXX101916101913
G→A102192XXXX102117102114
A→G102203XXXX102128102125
Insertion, TCAAGCTTTAAAAACGTACCCCAAACTTAAAACGCTCAAATTGCCTTTTGGAGGCCTGCCCAACGGCCATTATCCCTTGGATCTAAGATTGATTTGCGGTAACGTTTGCCAA102219XX--102144102141
C→A102309XXXX102234102231
A→C102351XXXX102276102273
A→G102458XXXX102383102380
T→G102601XXXX102526102523
T→C103043XXXX102968102965
A→G104898XXXX104823104820
C→G105010XXXX104935104932
T→C105012XXXX104937104934
T→C105015XXXX104940104937
T→C105017XXXX104942104939
Insertion, C105020X-XX104946104943
Deletion, G105054XXXX104979104976
Deletion, G105071XXXX104995104992
Insertion, ACAA105145XXXX105075105072
A→A/G105169-XXX105097105094
A→A/G (ORF 62), L→S105310-XXX105238105235
A→G (ORF 62), G, silent105312XXXX105240105237
T→C (ORF 62), I→V105356-XXT/C105284105281
A→G (ORF 62), L→P105451XXXX105379105376
A→C (ORF 62), S→A105512XXXX105440105437
A→G (ORF 62), V→A105544-XXX105472105469
T→C (ORF 62), A, silent105705-XXX105633105630
T→C (ORF 62), R→G106262-XXX106190106187
T→C (ORF 62), A, silent107136-XXT/C107064107061
C→T (ORF 62), A→T107165XXXX107093107090
T→C (ORF 62), S→G107252-XXX107180107177
T→C (ORF 62), R, silent107307XXXX107235107232
A→A/G (ORF 62), V→A107599-XX-107527107524
C→A (ORF 62), T, silent107607XXXX107535107532
T→C (ORF 62), A, silent107715XXXX107643107640
T→C (ORF 62), P, silent108111-XXX108039108036
A→G (ORF 62), L, silent108747XXXX108675108672
A→A/G (ORF 62), M→T108838-XXX108766108763
G→A (ORF 62), H, silent108951XXXX108879108876
C→G (ORF 62), A, silent109044XXXX108972108969
A→A/G109137-XXX109065109062
A→A/G109200-XX-109128109125
T→C/T109546--X-109474109471
G→T109654XXXX109582109579
Insertion, CAT109696XXXX109625-109627109622-109624
Insertion, GGGAGGGGGCGCGGTACCCCGCCGATGGGGAGGGGGCGCGGTACCCCGCCGATGGGGAGGGGGCGCGGTACCCCGCCGATGGGGAGGGGGCGCGGTACCCCGCCGATG109907XX--109838109835
Insertion, GGGAGGGGGCGCGGTACCCCGCCGATG109907X---109838109835
G→A110003XXXX109934109931
Deletion, G110058XXXX109988109985
G→A (Ori), -, silent110112XXXX109934109931
Deletion, AT110212-XX-110142110140-110141
T→G110214---X110141
Insertion, ATATAG110214X---110142110141
T→G (Ori)110216XXXX110144110143
T→G (Ori)110218XXXX110146110145
T→G (Ori)110220XXXX110148110147
T→G (Ori)110222XXXX110150110149
T→G (Ori)110224XXXX110152110151
T→G (Ori)110226XXXX110154110153
A→G (Ori)110232XXXX110160110159
A→G (Ori)110235XXXX110163110162
Deletion, GC110378-110379XXXX110305110304
A→G (ORF 63), T, silent111312XXXX110238110237
A→G (ORF 64), Q→R111650-XA/GA/G111576111575
T→C (ORF 64), Y→H112093XXXX112019112018
Deletion/insertion112128Del ADel AIns 5aIns A112064-112068112063
G→A112198XXXX112129112124
A→G (ORF 66), S, silent114140XXXX114071114066
G→A (ORF 67), P, silent115041XXXX114072114967
C→T (ORF 68), T→I115926XXXX115857115852
C→T117699XXXX117630117625
Deletion/insertion117769Del TDel TIns 5TIns T117701-117705117696
A→G (ORF 69), Y→H117804XXXX117740117731
T→C (ORF 69), Q→R118247-XT/CT/C118183118174
T→C (ORF 70), T, silent118585XXXX118521118512
Deletion, GC119518-119519XXXX119453119444
Insertion, CTCTCT119654XX--119588119579
T→C (Ori)119656XX--119590119581
T→C (Ori)119665XXXX119599119590
A→C (Ori)119671XXXX119605119596
A→C (Ori)119673XXXX119607119598
A→C (Ori)119675XXXX119609119600
A→C (Ori)119677X-XX119611119602
Deletion, ATATATAT119677-119684-X-119611-119618119602-119609
A→C (Ori)119679X-XX119613119604
A→C (Ori)119681X-XX119615119606
A→C (Ori)119683X-XA/C119617119608
C→T (Ori)119785XXXX119719119710
Deletion, C119847XXXX119780119771
C→T,119894XXXX119827119818
Insertion, TACCGCGCCCCCTCCCCATCGGCGGGGTACCGCGCCCCCTCCCCATCGGCGGGGTACCGCGCCCCCTCCCCATCGGCGGGGTACCGCGCCCCCTCCCCATCGGCGGGGTACCGCGCCCCCTCCCCATCGGCGGGG120135XX--120068120059
Insertion, TACCGCGCCCCCTCCCCATCGGCGGGG120135X--120068120060
Insertion, GAT120202XXXX120136-120138120127-120129
C→A120243XXXX120179120170
A→A/G120351--X-120287120278
T→T/C120697-XX-120633120624
T→T/C120760-XXX120696120687
G→C (ORF 71), A, silent120853XXXX120789120780
C→T (ORF 71), H, silent120946XXXX120882120873
T→C/T (ORF 71), M→T121059-XXX120995120986
T→C (ORF 71), L, silent121150XXXX121086121077
A→G (ORF 71), P, silent121786-XXX121722121713
A→G (ORF 71), A, silent122182XXXX122118122109
G→T (ORF 71), T, silent122290XXXX122226122217
T→C/T (ORF 71), V→A122298-XX-122234122225
A→G (ORF 71), R, silent122590XXXX122526122517
A→G (ORF 71), S→G122645-XXX122581122572
G→A (ORF 71), A→T122732XXXX122668122659
A→G (ORF 71), A, silent122761-XXA/G122697122688
A→G (ORF 71), R→G123635-XXX123571123563
A→G (ORF 71), A, silent124192-XXX124128124119
T→C (ORF 71), V→A124353-XXX124289124280
T→G (ORF 71), S→A124385XXXX124321124312
T→C (ORF 71), L→P124446XXXX124382124373
A→G (ORF 71), I→V124541-XXA/G124477124468
T→C (ORF 71), G, silent124585XXXX124521124512
T→C (ORF 71), L→S124587-T/CT/CT/C124523124514
T→T/C124728-XXX124664124655
Insertion, TGTT124750XXXX124687-124690124678-124681
Deletion, C124834XXXX124773124764
Deletion, C124851XXXX124789124780
A→G124880NANAXX124818124809
A→G124882NANAXX124820124811
  • a A partial analysis of 20 of these nucleotide differences was published previously (70). Nucleotide positions within ORFs are indicated, as well as the encoded amino acids. Ori, origin of replication; WT, wild type. X, difference relative to Dumas strain; -, identical nucleotide relative to Dumas strain; NA, not applicable; Del, deletion; Ins, insertion. Where applicable, the resulting codon switch is specified.