TABLE 5.

Comparison of complete genomic sequences of Oka-P and Oka-V strains of VZVa

Feature relative to WT (Dumas)Position (WT)Feature in:Position in:
Oka-POka-VOka-VGSKOka-VMerckOka-VGSKOka-VMerck
T→C560-XXX559559
T→T/C (ORF 1), Q, silent703-XCC702702
T→T/C (ORF 1), P, silent763-XCC762762
C→G (ORF 2), G, silent1838-X--18371837
T→T/C2515-XC-25142514
A→G (ORF 6), S→P5745-XXA/G57445744
T→C/T (ORF 9A), W→R10900-XX-1089910899
C→C/T (ORF 10), A→V12779-XX-1277812778
Insertion (ORF 11, R1), CGCGATCGACGACGAGGGAGAGGCGGAGGAGGA14242XXX14164-1419614164-14196
T→T/C (ORF 14), stop19431-X--1938519385
A→G (ORF 18), N, silent26125-XXA/G2607626076
C→T/C (ORF 21), T→I31732-X--3168331683
T→T/G (ORF 22), P, silent39227-XX-3917839178
C→T (R3 repeat), A→V41476XXX4142741427
Deletion, GCGCAGCCC41475-83-X--41426-4143441426-41434
G→C (R3 repeat), A→V41476XXX4142741427
Deletion/insertion42403Del AAADel AAIns ADel A4235542353
A→G (ORF 31), I→V58595-A/GA/GX5853158529
A→A/G (ORF 31), P, silent59287-XXX5922359221
A→G (ORF 35), A, silent64067-XXA/G6400364000
T→C (ORF 39), M→T71252-XXC/T7118871185
A→A/G (ORF 45), P, silent82225-X--8216082157
G→A/G (ORF 47), E, silent84091-X--8402684023
A→A/G (ORF 50), C, silent87280-X--8720587202
T→C/T (ORF 50), S→G87306-X--8723187228
A→G (ORF 51), T, silent89734-XX-8965989656
A→A/G (ORF 52), I→V90535-XX-9046090457
T→C (ORF 54), L, silent94167-XXT/C9409294089
G→A/G (ORF 55), A→T97748-XXX9767397670
T→C/T (ORF 55), C→R97796-XX-9772197718
Insertion, C105020XXX104946104943
A→A/G105169-XXX105097105094
A→A/G (ORF 62), L→S105310-XXX105238105235
T→C (ORF 62), I→V105356-XXT/C105284105281
A→G (ORF 62), V→A105544-XXX105472105469
T→C (ORF 62), A, silent105705-XXX105633105630
T→C (ORF 62), R→G106262-XXX106190106187
T→C (ORF 62), A, silent107136-XXT/C107064107061
T→C (ORF 62), S→G107252-XXX107180107177
A→A/G (ORF 62), V→A107599-XX-107527107524
T→C (ORF 62), P, silent108111-XXX108039108036
A→A/G (ORF 62), M→T108838-XXX108766108763
A→A/G109137-XXX109065109062
A→A/G109200-XX109128109125
Insertion, GGGAGGGGGCGCGGTACCCCGCCGATG109907X---109838109835
Deletion, AT110212-XX-110142110140-110141
Insertion, ATATAG110214X---110142110141
A→G (ORF 64), Q→R111650-XA/GA/G111576111575
T→C (ORF 69), Q→R118247-XT/CT/C118183118174
A→C (Ori)119677X-XX119611119602
Deletion, ATATATAT119677-119684-X--119611-119618119602-119609
A→C (Ori)119679X-XX119613119604
A→C (Ori)119681X-XX119615119606
A→C (Ori)119683X-XA/C119617119608
Insertion, TACCGCGCCCCCTCCCCATCGGCGGGG120135X---120068120060
T→T/C120697-XX120633120624
T→T/C120760-XXX120696120687
T→C/T (ORF 71), M→T121059-XXX120995120986
A→G (ORF 71), P, silent121786-XXX121722121713
T→C/T (ORF 71), V→A122298-XX122234122225
A→G (ORF 71), S→G122645-XXX122581122572
A→G (ORF 71), A, silent122761-XXA/G122697122688
A→G (ORF 71), R→G123635-XXX123571123563
A→G (ORF 71), A, silent124192-XXX124128124119
T→C (ORF 71), V→A124353-XXX124289124280
A→G (ORF 71), I→V124541-XXA/G124477124468
T→C (ORF 71), L→S124587-T/CT/CT/C124523124514
T→T/C124728-XXX124664124655
  • a Ori, origin of replication; WT, wild type. X, difference relative to Dumas strain; -, identical nucleotide relative to Dumas strain; Del, deletion; Ins, insertion. Where applicable, the resulting codon switch is specified. Boldface highlights homologies between genomic sequences of Oka-V and genomic sequences of Oka-VGSK and/or Oka-VMerck.