TABLE 1.

Oligodeoxynucleotides used in this studya

NameSequence
885(−)CCCTCTAGAACGCCCCGAAACCTAGGGTGGCG
1030(−)CCCTCTAGACTCGAGGGAATTTCCTGGAC
1184(+)GACGGCTAAGCGTAGGCTGGCCAGGGGATCTCCCCCCTCCTTGGCCAGCTCATCAGCTGACCAGCTGTCTGCGCCTTCC
1287(+)AGACCGTGCACCAGACCACAACGGTTTCCCTCTAGCGGGATCAATTCCG
1288(−)CCAGTAACGTTAGGGGGGGGGGAGGGAGAGGGGCGGAATTGATCCCGCT
1289(+)CCAAAGGGCGCGCCATGCAGATCTTCGTGAAGACC
1290(−)AATAGGAGCTCCACCGCGGAGACGC
1291(+)CGGTGGAGCTCCTATTACGGCCTACTCCCAAC
1292(−)ATTGGTGTACATTTGGGTGATTGG
1293(+)TCTGGAAGCTTCTTGAAGACA
1294(−)GGCTTGACGTCCTGTGGGCGGCGGTTGGTGTTACGTTTGGTTTTTCTTTGAGGTTTAGGATTCGTGCTCATTATTATCGTGTTTTTCAAAGG
1319(+)AGACGGCTAAGCGTAGGCTGGCCAGGGGATCTCCCCCCTCCTTGGCCAGCTCATCAGCTGTACAGCTGTCTGCGCCTTCC
1320(+)AGACGGCTAAGCGTAGGCTGGCCAGGGGATCTCCCCCCTCCTTGGCCAGCTCATCAGCTGCCCAGCTGTCTGCGCCTTCC
1322(+)AGACGGCTAAGCGTAGGCTGGCCAGGGGATCTCCCCCCTCCTTGGCCAGCTCATCAGCTTACCAGCTGTCTGCGCCTTCC
1324(+)AGACGGCTAAGCGTAGGCTGGCCAGGGGATCTCCCCCCTCCTTGGCCAGCTCATCAGCTGAACAGCTGTCTGCGCCTTCC
1325(+)AGACGGCTAAGCGTAGGCTGGCCAGGGGATCTCCCCCCTCCTTGGCCAGCTCATCAGCTACACAGCTGTCTGCGCCTTCC
1326(+)AGACGGCTAAGCGTAGGCTGGCCAGGGGATCTCCCCCCTCCTTGACCAGCTCATCAGCTATCCAGCTGTCTGCGCCTTCG
1327(+)AGACGGCTAAGCGTAGGCTGGCCAGGGGATCTCCCCCCCCCTTGACCAGCTCATCAGCTATCCAGCTGTCTGCGCCTTCC
1356(−)CCGCTCTAGATACGTGATGGGGGCACCCGTGGTGATGGTCCTTACCCCGATTCTGATGTTAGGGTCGATAC
1358(+)CCGATGTACACCAATGTGGACCAGGACCTCGTCGGCTGGCGAGCGCCCCCCGGGGCGCGTTCC
1359(+)CCGCGTGCACCCGAGGGGTTGCGAAGGCGGTGGACTTTGTACCCGTCGAGTCTATGGGAACCACTATGCGGTCCCCGGTC
5′Ala(+)CCACGCTAAGCGTAGGCTGGCCAGGGGAGCACCCCCCTCCTTGGCCAGCTC
5′Asp(+)CCACGCTAAGCGTAGGCTGGCCAGGGGAGATCCCCCCTCCTTGGCCAGCTC
  • a Nucleotide changes are highlighted in boldface type, and the resultant codon is underlined. Restriction sites used for cDNA cloning are underlined. The polarities of oligonucleotides are indicated as either the HCV genome RNA sense (+) or its complement (−).