TABLE 1.

List of primers used in the study

NamePosition or motifaPolaritySequence (5′ to 3′)
P7763724-3741+GCAAGGTCATCGTCAACG
P774bGDCG+CCACACCAGGWGAYTGYGG
P802bGXXGXGKT+GGCCMCCCKGGIWKIGGIAA
P1080510-489GGAGTTGTTGTGTCCATCCGC
P10686360-6400+CAAGTGGGATACAAACTATGCACTCTGCCCTTTCTGCTAAG
P10356568-6588+TAGTGGTTCTCTGAGTAGGTT
P1082272-242GCCCCAGGGATGGGTCAGGCCATTGAGACGG
P1F5-26+GACTAGAGCTATGGATACGTCC
P1R1479-1497TTGCCATACGAGCATTCCC
P2F1214-1236+TTGGCTCAACACTGTGCAAAAG
P2R2998-2979TACCAAATCTGGGTGGTCTC
P3F2397-2414+CCCAGTGATGATTATTAC
P3R4358-4338TCACAAGAATCCAGAACAACC
P4F4239-4258+ATTAAAGACAAGTGTGCTCG
P4R5993-5973CGCCAGCCATTATCTAAAGAC
P5F5656-5674+CTTCAAAAACCACGACTAC
P5RcPoly(A) tailAGCGTCGAGCGGCCGC(T)15
P8851214-1236+TTGGCTCAACACTGTGCAAAAG
P8861737-1716CTGATTGCATTTTCCAAACAGC
  • a Position nos. or motif of the 5′ and 3′ nucleotides on the TV genome.

  • b Primers targeting conserved amino acid motifs in the protease or NTPase, respectively.

  • c Oligo(dT) primer with a NotI site overhang.