TABLE 1.

Oligonucleotide primers used to insert UUK promoter mutations and for vRNA and cRNA analyses

PrimerSequenceDescription
RF35AATGAAGACGG⌊GGGACACAAAGACGGCTACCATGGWild-type 3′ UUK NTR (vRNA)
BbsI3′UUK NTR (vRNA)
RF107AATGAAGACAT⌊AGGTACACAAAGACACGGCTACATGGAACWild-type 5′ UUK NTR (vRNA)
BbsI5′UUK NTR (vRNA)
RF147AATGAAGACGG⌊GGGAGACAAAGACGGCTACCATGGAGAExample of 3′ UUK mutation (G2C)
BbsI3′UUK NTR (vRNA)
RF155AATGAAGACAT⌊AGGTACACGAAGACACGGCTACATGGAACExample of 5′ UUK mutation (A5G)
BbsI5′UUK NTR (vRNA)
RF177CATGGAAGCCATCACAGACPCR primer for amplifying UUK M-CAT vRNA molecules
CAT ORF
position 245 to 263 (UUK NTR M-CAT [vRNA])
RF267ACGGCTACCATGGAGAAAAAAATCPrimer for RT of UUK M-CAT vRNA molecules
3UUK NTR (vRNA)CAT ORF
position 853 to 831 (UUK NTR M-CAT [vRNA])
RF178AAGACGGTGAGCTGGTGATPCR primer for amplifying UUK M-CAT cRNA molecules
CAT ORF
position 250 to 268 (UUK M-CAT [cRNA])
RF268GACACGGCTACATGGAACAACAAATAPrimer for RT of UUK M-CAT cRNA molecules
3′UUK NTR (cRNA)
position 855 to 830 (UUK M-CAT [cRNA])