TABLE 1.

Sequences of primers used for PCR and 3′ RACE

PrimerSequence (5′-3′)
PAB201CCCTTCCTGACTACTAATGTAC
PAB431AACGTGACGAGTCGGAGTCCAGAGTC
PAB435GCAAGCTGTTCATGACGGGATAC
PAB464GATCGATAACTTCGTATAATGTATGCTATACGAAGTTATC
PAB465GATCGATAACTTCGTATAGCATACATTATACGAAGTTATC
PAB466CCCCTTAAGCTTATAACTTCGTATAATGTATGC
PAB467CGACATATGGATCCCCGCATGGTTTCCATTGAG
PAB468TTTCAGCTGGATCCAGCTCGGACTGACATTCGG
PAB469GGGTCGACAAGCTTATAACTTCGTATAGCATACAT
PAB489AACATCCTGGGGCACAAGCTGGAGTAC
PAB534GCATCCTGGGCTACACTGAG
PAB548GCAGTGGAGACTGCAAATCAAGG
PAB549GGTATGCCGAGAGAGTATCTCGC
PSV40FACGCGTCGACAGTTAGGGTGTGGAAAGTCC
PSV40RCGCGGATCCTCACTACTTCTGGAATAGC
SFV119GATGGAACCGGATCCAAGTC