TABLE 1.

Oligonucleotide primers and probes used in this study

NameSequenceMap positionaComments
BR16GAAGCTAATCCGATGGTT364-381
NS7CCGAACGAGGTCCGAACA476-493
NS9CTTTCGCCTCTTCCATGGG3261-3279Natural NcoI site at position 3268 in bold
NS16AGCTTTGGCCCGCTCGGCG1851-1869
NS17CACGGATCCCGTGGCCGCCACGAAGGTCCAC2327-2349Added BamHI site in bold
NS18CATGGATCCAATGTATAAGGAAGCCGAACGACCTATTG2363-2391Added BamHI site in bold
NS19CACGGATCCTGCGTCGTCACGGGCCCGCCCGTC1573-1598Added BamHI site in bold
NS20CACGGATCCCGGCCGCGCGTTTGGTTACGTGC2128-2152Added BamHI site in bold
NS22CGCCACACTTCAATAGGTCG2382-2401
NS35CACAGATCTCGGCCGCCAATCCGGGCAAGGG1223-1245Added BglII site in bold
NS40CACGGATCCTCGTCGCCTTTGGGCGAGATACG1470-1492Added BamHI site in bold
NS41CACGGATCCAACCATTGTCTCCGTTGGCAAGG1354-1378Added BamHI site in bold
NS42CACGGATCCACAACGCCTTGCTGGTCTCTCC1645-1668Added BamHI site in bold
NS44CACGGATCCGCTCGCTGCCGAGTTTGCGCC1252-1274Added BamHI site in bold
NS45ACAGGATCCACAGGTTACCCGCCGTAAAGG1305-1328Added BamHI site in bold
NS46CACGGATCCCACCAGCATCCAGGATGCTCTTG1392-1414Added BamHI site in bold
NS47CACGGATCCGAACGTCAATTTCGGCCGTCGTG1431-1453Added BamHI site in bold
NS57MTGACTGGTCGTGACCCCAACCATTGTCTCCGTTGG1340-1373Inserted C residue in bold
NS58MCTTGTGGCTACGGAGT(t)GAGGAACGTCAATTTCGGC1411-1446Deleted T residue indicated by (t)
NS52PEGCGCCGAAGGGTTTTGTA12471-12488Used in real-time PCR
NS53PEGACCGAAGCAAGCACAGAGACT12341-12362Used in real-time PCR
NS52TPACAACGAAGCGCGTAGCCCATACTTTC12433-12459TaqMan probe used in real-time PCR
PDF1373FATAACAGGTCTGTGATGCCCTTAGA1373-1397Used in real-time PCR
PDF1439RCTCGCTGGCTCTGTCAGTGTAG1418-1439Used in real-time PCR
PDF1400TTTCTGGGCCGCACGCGC1400-1416TaqMan probe used in real-time PCR
  • a Numbers refer to map positions on the CHV1-EP713 genomic dsRNA (28) for the NS series of oligonucleotides and BR 16 and on the C. parasitica 18S rRNA (6) for the PDF series of oligonucleotides.