TABLE 1.

Oligonucleotides used for construction of plasmids and recombinant BACs and sequencing reactions

Primer nameSequence
5′ pp71/pKD13GAAGACCCGTTCACCTTTGCGCATCCCCTGACCCTCCCCCCATCCCGCCTGTGTAGGCTGGAGCTGCTTC
3′ pp71/pKD13TAGAAATAAATACAGGGAATGGGAAAAACACGCGGGGGAAAAACAAAGAAATTCCGGGGATCCGTCGACC
5′ IE1 upstream/pKD13TGCTATTGGGTCACAGCCGCGTGCCGCGGGTGCGCGCAGAAGAATGTTGCGTGTAGGCTGGAGCTGCTTC
3′ IE1 upstream/pKD13AGATGTACTGCCAAGTAGGAAAGTCCCATAAGGTCATGTACTGGGCATAAATTCCGGGGATCCGTCGACC
5′ IE1 upstreamCCATTGACGTCAATGGGGTGG
3′ IE1 upstreamTCTGTACCCATCCCAATCTCA
5′ pKD13-pp71ACACCTGTCACCGCTGCTATATTTG
3′ pKD13-pp71CCGTGATACCCTAATAAAGCACACCG
5′ Daxx_SpeITGACTAGTCATGGACTACAAAGACGATGAC
3′ Daxx_SacIIACTCCGCGGCCTCAGTCATCTGCTTCC