TABLE 1.

Names, sequences, nucleotide positions on ORF2, and polarities of primers used in this study

PrimerSequence (5′ to 3′)Positionsa (nt)SenseRestriction enzyme siteMutant(s) generated
NV110aGCGGCGAGATCTAATTCGTAAATGATGATGGCG5349-5371PlusBglIICT303, ID285, ID328, CT74, CT230
NV111aGCGGCGAGATCTAATTGCACCAATTATGGCTT6957-6976MinusBglIINT20, ID285, ID328
NV115aGCGGCGAGATCTATGGTACCGGAGGTTAATGCTT5419-5439PlusBglIINT20
NV102CGGGATCCATGAAGATGGCGTCGAATGAC5358-5378PlusBamHINT34
NV109CCCGGGGGATCCAATTGCACCAATTATGGCTT6957-6977MinusBamHINT34
NV-NT98-AUGCCGGGGATCCGAAATGATGATGGCGTATAATGGTTGGGTTGG5655-5671PlusBamHINT98
NV-3′VCR-XhoCCCGCTCGAGAACATCAAATTAAACCTAAT7635-7654MinusXhoINT98
NV-CT20GCGGCGCTCGAGAAATCTGGACACCCATGAAAC6857-6888MinusXhoICT20
NV112aGCGCGAGATCTTCAAGCCTCACCTACAGTAGGG6707-6725MinusBglIICT74
NV114aGCGGCGAGATCTTCAGTTGATTACAGTGCCATT6240-6257MinusBglIICT230
NV123GGCACCACCCCAGTTTCATTGCTTACTGAATTGGATGGCACA6189-6209/6257-6278PlusNoneID285
NV125TGTGCCATCCAATTCAGTAAGCAATGAAACTGGGGTGGTGCC6189-6209/6257-6278MinusNoneID285
NV124CCAGACCTCGGTGGTTGTGATGATGTAGACACCACCCCTGAC6318-6338/6387-6408PlusNoneID328
NV126GTCAGGGGTGGTGTCTACATCATCACAACCACCGAGGTCTGG6318-6338/6387-6408MinusNoneID328
NV132GGCCTGATCAATGATGATGGCGTCTAAGGAC5357-5378PlusBclICT20, ID375
NV133CCCGCTCGAGCATCGCCTATTATTTGCGAAT7567-7588MinusXhoIID375
NV134TATGTTGGTGTTCTTAGCTCCCAAGTTGACCTTTGGAAGATC6462-6478/6508-6533PlusNoneID375
NV135GATCTTCCAAAGGTCAACTTGGGACCAGCTAAGAACACCAACATA6462-6482/6510-6533MinusNoneID375
NV-CT303CCGCTCGAGAACATCAAATTAAACCTAATTAAACCTAATTAAATGAA TATGATGCCCACATTTCATATTA CAACAATAGGTTTTCTGCTCCAC CGTAGGAG6319-6341/7589-7654MinusXhoICT303