TABLE 1.

Primers used to construct selected MCMV gene expression plasmids

GenePlasmid namePCR template5′ primer3′ primer
No.SequenceNo.Sequence
m128pEQ1039pBH341542GGATCCACCATGGAGCGTGTTCGGGGAGCT543CTGAATCTTCTTCCTGACGGT
m139pEQ1040pBH341544GGATCCACCATGTGGTCTCTCCGCGGCGCC545GCGATCGGAGCCGGTTTCCAT
m140pEQ1041pBH341378ACCATGGACAGCACACTGTGGGAG379CGGTCTGCAGAGTCTGAGCGG
m141pEQ1042pBH341546GGATCCACCATGGAGAGGCCGGTGACGGCG547GGTCTCCGAGGGACCCGGCC
m142pEQ985pBH341461ACCATGGACGCCCTGTGCGC462GTCAGTCGTCATCGTCGGCGT
m143pEQ939pBH341410ACCATGTCTTGGGTGACCGGAGAT411GAGAGATGACATGTCGTCACA
M23pEQ1045pBH303550GGATCCACCATGGCGCCTCCGGAAGCTCTC551CCTCCTTTTGATGGAGCGCAT
M24pEQ1046pBH303552GGATCCACCATGGATTCGACGGGGAAAATC553GAACTCGCTGAGGCGCGGGG
m25.1pEQ1047pBH303554GGATCCACCATGTGGGGACGACAGGTTCTT555GTGTCTGACTTTATTGATATC
m25.2pEQ1048pBH303556GGATCCACCATGCCTGCTTCATCATGTACG557GACCGCTTTCAAAAAGAACCT
M36pEQ1049pBH400558GGATCCACCATGTATGAGCAAGAGGAACAA559TCGATATCCCCGTGTCATCTT
M43pEQ1050pBH400560GGATCCACCATGACAACGACGTTGACGGGG561TTGATGTCGGCAACACACCGT