TABLE 1.

PCR amplification and sequencing primers

ORFAmplification primersSequencing primer(s)
NameSequence (5′-3′)NameSequence (5′-3′)
88fAATTATTGGTGGGCAGAACC8sCCATCACCACGCTATTCTC
8rTTCTCCAGCACAGCAACG
1111fCTGTAACGATGCTAACGCTACG11sf1TAGCCCAAACGACGACAAAG
11rTTCAGAAACCTGTCCAGGTCC
1515fCAAAGCGCAAAGCAAAATGC15sf1ATCCAACACACGCAACATC
15rGGGCCTTGTAGATCAGCTCTCC
3030f1GCGCTACTTCTGAAAACG30-1sTACCCAAGCATTATCCAG
30r1CCACAAACTTGATAAACACG30-1sr1GATAACCCTGACGGAGTAAG
30f2AAACCACAAGCCTTACTCC30-2sGAGAAGACCTTTCAGCGAC
30r2GCGCAACTATCACATACG30-2sr1CTCAGCAGTCATAACGAAC
3131fGGACTTACCGTCGAACAGACC31sr1GGAGACAGGTTGAGAGAAG
31rACCCAGTACGTAGCCATGAAGC31srCAGCCTCGCAAGCGCGGGTGAGGT
3232fTGATTACTACTACCCCCCTCC32sf1TATTTCTGACACCCACCAC
32rAGCCAGATTCACGTCATCC
3737fACATACTCCGCCATCTCC37sCCATCTATAACGCCAGCC
37rACAGCTACATGACTCGTGC
4040fATCACAAACGCATCCTCG40sACTCGCCGAATCCCAGATG
40rCACAGCTCACCCAAAATACC
4242f1ATCCCAGCGCAACTCTTAC42fs1GGCAAGTATAACCTGAACGG
42r1GTCCGTAGAGCTGAGTAGAG42rs1TGAAACAGCGAACACGGGTC
4545fTGGCACGAAAGCACTACG45sr1TGATCTATCAGAGCCAAC
45rAAACCTGCACGAATGTTGG
5050fACTCGACTCAGACTACATTGG50sr1GCTCACTAAATAGCCAAAC
50rATAGCAGAATGGGGATAGC
5252fCCAACAGCTTTCACATCACC52sGCTACTTCGTTCACTTCC
52rTTCAAATTCCTCGCTCACC
5757f1GGTGCTGAACGTAAACCTG57fs1CGTAAACCTGAGCGAG
57r1CTCAGGGCTGCTAATATATGC57rs1GTAGAAACCTTGACGACACGG
6767fCAAAACTCCAACACCACG67sGAAGAAGCATTCGCCAAG
67rGAGAAGAGGTTCTACAAGCAGC
6868fAGCATTGCCAAACAGTTCC68s1GAAGATAGAATGGGTGTGAG
68rCAAGAAACCACTGCTCAACC68s3ACCGTTGAGCATAATCATCC
68r2GTCCCCTACCTTTTAACG
68r3CGGCGGCCGTGGACCGA
7373fGAACATATGAGCATGTACC73sACGGACAACGCTTACCCAC
73rGACCAGTAGAACATCTTCC