TABLE 1.

Oligonucleotide primer and probe sequences for real-time RT-PCR

GenePrimer and probe setcSequenceGenBank accession no.a
FMDVbFMDV FACTGGGTTTTACAAACCTGTGA
FMDV RGCGAGTCCTGCCACGGA
FMDV TTCCTTTGCACGCCGTGGGAC
GAPDHPorcine GAPDH-327FCGTCCCTGAGACACGATGGTAF017079
Porcine GAPDH-380RCCCGATGCGGCCAAAT
Porcine GAPDH-348TAAGGTCGGAGTGAACG
IFN-βPorcine IFN-β-11FAGTGCATCCTCCAAATCGCTM86762
Porcine IFN-β-69RGCTCATGGAAAGAGCTGTGGT
Porcine IFN-β-32TTCCTGATGTGTTTCTC
RANTESPorcine RANTES-54FTGGCAGCAGTCGTCTTTATCAF14636
Porcine RANTES-125RCCCGCACCCATTTCTTCTC
Porcine RANTES-101TTGGCACACACCTGGCGGTTCTTTC
p65/RelAPorcine RelA-786FGGAACACGATGGCCACTTGHomologene 32064/NM021975
Porcine RelA-881RAAGAGGACATCGAGGTGTATTTCAC
Porcine RelA-825TAAAAGGAGCCTCGGGCCTCCCA
TNF-αPorcine TNF-α-338FTGGCCCCTTGAGCATCANM214022
Porcine TNF-α-405RCGGGCTTATCTGAGGTTTGAGA
Porcine TNF-α-356TCCCTCTGGCCCAAGGACTCAGATCA
  • a NCBI GenBank accession number.

  • b Primers and probe were obtained from reference 9.

  • c F, forward primer; R, Reverse primer; T, TaqMan 6-carboxyfluorescein-MGB probe.