TABLE 1.

PPMO sequences and target locations in the FMDV genomea

PPMOPPMO sequence (5′-3′)Location of PPMO target sequence in FMDV A24CruaPPMO target region in FMDV
5+AACCCTAGCGCCCCCTTTCAA1-215′ Terminus of genome
CRECTTAGATCGTGTTTGTACAAG569-589cis-Acting replication element in 5′ UTR
5DTTAAAAGAAAGGTGCCGGCCT1015-1035Domain 5 of the IRES
AUG1GTGTTCATAAGTCCAGTGTAA1036-1056First AUG of polyprotein gene
AUG2GAATTCCATCCTTCCTGTGGC1121-1142Second AUG of polyprotein gene
3′SLACTCCTACGGCGTCGCGCGCC8085-8105Near end of 3′ UTR
AUG2scrCTCAGCTGTCGTCAGTCTACTAUG2 scrambled sequence control
DSscrAGTCTCGACTTGCTACCTCANonsense sequence control