TABLE 2.

Primers for real-time PCR assays

PrimerSequence (5′-3′)
ForwardReverse
GAPDHGTCTGGAAAAACCTGCCAAGACCTGGTGCTCAGTGTAGCC
CD4TATGCTGGCTCTGGAAACCTCTGAGTGGCTCTCATCACCA
FoxP3GCTGGAGAAGGAGAAGCTGACACAGATGAAGCCTTGGTCA
CTLA-4ATCTGCAAGGTGGAGCTCATAATCTGGGTTCCATTGCCTA
IDOACAGAATGCTGGTGGAGGACGGAAGTTCCTGTGAGCTGGT
SIVgagGCAGAGGAGGAAATTACCCAGTACCAATTTTACCCAGGCATTTAATGTT
IL-2AACTCACCAGGATGCTCACAGCACTTCCTCCAGAGGTTTG