TABLE 1.

Primers for real-time analysis

TargetPrimer sequence (5′-3′)Product size (bp)Reference
ForwardReverse
GAPDHATGTCAGATCCACAACGGATACATACTCCCTCAAGATTGTCAGCAAT307 42
IFN-βGGAGATGACGGAGAAGATGCCCCAGTGCTGGAGAAATTGT107 45
IFN-αATGGCTAGGCYCTGTGCTTTCTCTGAYCACCTCCCAGGCACA492 8
IRF7CAGCGAGTGCTGTTTGGAGACAAGTTCGTACACCTTATGCGG351 7
MCP-1ATCCCAATGAGTAGGCTGGAGAGCGGTGGTTGTGGAAAAGGTAGTGG279 34
WNV NS5CGGTCGGAAAAGTGATTGACCGCCCTTTGTGTACCCTCTGACTTC100This study