TABLE 1.

PTV reassortant genotyping primers

Virus genome segmentVc primer sequenceVs primer sequence (product size [bp]) for virus:
AdamesBalliet
LCTTCTCTTTGGCATATAGCATTCACTTGCAGATCTTACTTTCTTCATGA(250)GGATGTTTAGTCTTGACCTCAGT (350)
MACACAAAGACCGGCACATCTCACACCTTTATAAAGCACAGAGTAACTGGC(150)GTGCATATGAAGACCATCCAATCC (255)
SAGCCCAGCAGATGTGTTCTCTGAGAAATTCAAAAACACACTAACACTGAAACC(510)TTTTTTTTATTTTTTTGTTGTTTTATTTTATA(480)