TABLE 1.

RT-PCR primers and conditions

GeneaPrimer sequence (5′-3′)Ta (°C)bCyclesReference
LMP2AF: AGGAACGTGAATCTAATGAAGA553861
R: AAGTGACAACCGCAGTAAGCA
EBER1F: AAAACATGCGGACCACCAGC552561
R: AGGACCTACGCTGCCCTAGA
EBNA-LPF: AGAGGAGGAGGTGGTAAGCGGTTC553061
R: CTGGCTAAGCCTGTGACTTAG
BZLF1F: CACGGTAGTGCTGCAGCAGTTGC6130
R: CCCAGAATCAACAGACTAACCAAGCCG
BRLF1F: GCCATGAGGCCTAAAAAGGATGGC5630
R: GCCCAGCACCTTGCTGTAGGTGTA
VIL-10F: CGAAGGTTAGTGGTCACTCT523534
R: CACCTGGCTTTAATTGTCATG
BHRF1F: GTCAAGGTTTCGTCTGTGTG554013
R: TTCTCTTGCTGCTAGCTCCA
CIL-10F: CTGAGAACCAAGACCCAGACATCAAGG613528
R: CAATAAGGTTTCTCAAGGGGCTGGGTC
IL-6F: CCACTCACCTCTTCAGAA493540
R: GCGCAGAATGAGATGAGT
TGF-βF: GCTGCACTTGCAGGAGCGCAC523043
R: AAATGGATCCACGAGCCCAA
B2-microglobulinF: TTCTGGCCTGGAGGGCATCC562332
R: ATCTTCAAACCTCCATGATG
  • a EBNA-LP, Epstein-Barr virus nuclear antigen leader protein; TGF-β, transforming growth factor β.

  • b Ta, annealing temperature.