TABLE 2.

Primers and probes used for real-time PCR

Primer or probeSequence
Primers
    gG1 forward5′ CTGTTCTCGTTCCTCACTGCCT 3′
    gG1 reverse5′ CAAAAACGATAAGGTGTGGATGAC 3′
    ORF62 forward5′ TCTTGTCGAGGAGGCTTCTG 3′
    ORF62 reverse5′ TGTGTGTCCACCGGATGAT 3′
    hAlbumin forward5′ TGCATGAGAAAACGCCAGTAA 3′
    hAlbumin reverse5′ ATGGTCGCCTGTTCACCAA 3′
Probes
    gG1 P5′ FAM-CCCTGGACACCCTCTTCGTCGTCAG-TAMRA 3′
    ORF62 P5′ FAM-TCTCGACTGGCTGGGACTTGCG-TAMRA 3′
    hAlbumin P5′ FAM-TGACAGAGTCACCAAATGCTGCACAGAA-QSY 3′