TABLE 2.

Primers used for pBD cDNA construction with a binucleotide cloning strategy to amplify full-length cDNAs of the viruses

Gene segmentForward primerReverse primer
PB25′CCAGCAAAAGCAGGTCAATTAT5′TTAGTAGAAACAAGGTCGTTTTTAAACAAT
PB15′CCAGCAAAAGCAGGCAAACCA5′TTAGTAGAAACAAGGCATTTTTTCAT
PA5′CCAGCAAAAGCAGGTACTGATCCA5′TTAGTAGAAACAAGGTACTTTTTTGGA
HA5′CCAGCGAAAGCAGGGGTATAATC5′TTAGTAGAAACAAGGGTGTTTTTAACT
NP (DKGX/35)5′CCAGCAAAAGCAG GGTTGATAAT5′TTAGTAGAAACAAGGGTAT
NP (DKGX/22)5′CCAGCGAAA GCAGGGTAGATAAT5′TTAGTAGAAACAAGGGTAT
NA5′CCAGCAAAAGCAGGAGTTTAAAATGAAT5′TTAGTAGAAACAAGGAGTTTTTTGAACAA
M (DKGX/35)5′CCAGCAAAAGCAGGTAGATGTTGAAAGATG5′TTAGTA GAAACAAGGT AGTTTTTTACTC
M (DKGX/22)5′CCAGCGAAAGCAGGTAGATGTTGAAAGATG5′TTAGTAGAAACAAGGTAGTTTTTTACTC
NS (DKGX/35)5′CCAGCGAAAGCAGGGTGACAA5′TTAGTAGAAACAAGGGTGTTTTT TATCAT
NS (DKGX/22)5′CCAGCAAAAGCAGGGTGACAA5′TTAGTAGA AACAAGGGTGTTTTTTATCAT